Lsi1;OsNIP2;1

Gene Details

MSU gene ID: LOC_Os02g51110
RAPdb gene ID: Os02g0745100
Gene Symbol: Lsi1 OsNIP2 1 OsLsi1
Genome: MSU7 , IRGSP-1.0
Species: Oryza sativa

Functional Descriptions

Mutation in OsNIP2;1 (Lsi1, a silicon influx transporter) significantly decreases arsenite uptake.
The rice (Oryza sativa) silicon transporter Lsi1 (OsNIP2;1, an aquaporin channel) is the major entry route of arsenite into rice roots.
Recently, a gene (Low silicon rice1 [Lsi1]) encoding a Si transporter was identified in rice roots.
Consistent with the Si uptake pattern, Lsi1 expression and distribution of the Lsi1 protein were found only in the basal zone of roots.
In the basal zones of the seminal, crown, and lateral roots, the Lsi1 protein showed a polar localization at the distal side of both the exodermis and endodermis, where the Casparian bands are formed.
Recent studies have shown that arsenite is taken up by rice (Oryza sativa) roots through two silicon transporters, Lsi1 (the aquaporin NIP2;1) and Lsi2 (an efflux carrier).
The results demonstrate that Lsi1 mediates the uptake of undissociated methylated As in rice roots.
Herein, we show evidence that the uptake of selenite, a main bioavailable form of Se in paddy soils, is mediated by a silicon (Si) influx transporter Lsi1 (OsNIP2;1) in rice.
Immunostaining with Lsi1 and Lsi2 antibodies revealed a similar pattern of subcellular localization of these two Si transporters in both varieties; Lsi1 and Lsi2 were localized at the distal and proximal sides, respectively, of both exodermis and endodermis of the roots.
Whether Lsi1 also mediates arsenite efflux was investigated.
*Expression of Lsi1 in Xenopus laevis oocytes enhanced arsenite efflux, indicating that Lsi1 facilitates arsenite transport bidirectionally.
A rice mutant defective in Lsi1 (Lsi1) extruded significantly less arsenite than the wild-type rice and, as a result, accumulated more arsenite in the roots.
*We conclude that Lsi1 plays a role in arsenite efflux in rice roots exposed to arsenate.
The role of the rice aquaporin Lsi1 in arsenite efflux from roots.
A gene, Lsi1, that encodes a silicon influx transporter has been identified in rice.
Here we describe a previously uncharacterized gene, low silicon rice 2 (Lsi2), which has no similarity to Lsi1.
Involvement of silicon influx transporter OsNIP2;1 in selenite uptake in rice.
Mutation in Lsi2 had a much greater impact on arsenic accumulation in shoots and grain in field-grown rice than Lsi1.
Spatial distribution and temporal variation of the rice silicon transporter Lsi1.
Taken together, our results indicate that Si influx transporter OsNIP2;1 is permeable to selenite.
The expression of two Si transporter genes (Low silicon rice 1 [Lsi1] and Lsi2) investigated using real-time reverse transcription polymerase chain reaction revealed higher expression of both genes in Nipponbare than in Kasalath.
Here we describe the Low silicon rice 1 (Lsi1) gene, which controls silicon accumulation in rice, a typical silicon-accumulating plant.
Suppression of Lsi1 expression resulted in reduced silicon uptake.
Furthermore, expression of Lsi1 in Xenopus oocytes showed transport activity for silicon only.
Defect of OsNIP2;1 resulted in a significant decrease in the Se concentration of the shoots and xylem sap when selenite was given.
There was a negative correlation between the expression level of OsLsi1 and OsLsi2 and shoot Si accumulation when the rice seedlings were exposed to different Si supply conditions.
A split root experiment showed that the expression of both OsLsi1 and OsLsi2 was also down-regulated in half the roots without direct Si exposure when the other half roots were exposed to Si.
In conclusion, the Si-induced down-regulation of Si transporter genes is controlled by shoot Si, not root Si, and that the region between -327 to -292 in the OsLsi1 promoter is involved in this regulation of OsLsi1 expression in rice.
A split root experiment showed that the expression of both OsLsi1 and OsLsi2 was also down-regulated in half the roots without direct Si exposure when the other half of the roots were exposed to Si.
In conclusion, the Si-induced down-regulation of Si transporter genes is controlled by shoot Si, not root Si, and the region between -327 and -292 in the OsLsi1 promoter is involved in this regulation of OsLsi1 expression in rice.
Our results suggest that when overexpressed Lsi1 in cold-sensitive rice, it possibility regulates the transcription factor OsWRKY53 in addition to the genes involved in the ROS metabolism, thus mediating resistance to chilling stress.
Overexpression of Lsi1 in cold-sensitive rice mediates transcriptional regulatory networks and enhances resistance to chilling stress.
Our results demonstrate that Lsi1 overexpression or interference causes changes in both miRNA expression and antioxidant capacity in rice, and therefore modulates rice tolerance to UV-B radiation.
In rice, the accumulation of Si is controlled by the low silicon rice 1 (Lsi1) gene; overexpression of Lsi1 (Lsi1-OX) increases Si uptake and accumulation, while the reverse is observed in Lsi1-RNA interference (Lsi1-RNAi) transgenic rice.
Furthermore, the cellular localization of OsLsi1 was altered; OsLsi1 localized at the root exodermis of the wild-type rice was changed to be localized to other cell layers of the mutant roots.
The expression level of some transporter genes including OsLsi1 and OsLsi2 for Si uptake and OsNramp5 for Mn uptake was significantly decreased in the mutant compared with the wild-type rice.
Root silicon deposition and its resultant reduction of sodium bypass flow is modulated by OsLsi1 and OsLsi2 in rice.
In summary, our results reveal that Si deposition at root endodermis and its resultant reduction of Na+ bypass flow is modulated by OsLsi1 and OsLsi2 and regulated by the expression of OsLsi1 and OsLsi2, implying that root Si deposition could be an active and physiologically-regulated process in rice.
In this study, we investigated the roles of OsLsi1 and OsLsi2 in Si-induced reduction of bypass flow and its resultant alleviation of salt stress by using lsi1 and lsi2 mutants (defective in OsLsi1 and OsLsi2, respectively) and their wild types (WTs).
When OsLsi1 was ectopically expressed in the shoots, it showed polar localization at the xylem parenchyma cells of the basal node and leaf sheath, but not at the phloem companion cells.
The polar localization of both OsLsi1 and OsLsi2 was not altered by Si supply, but their protein abundance was reduced.
The polar localization of OsLsi1 and OsLsi2 was not altered by inhibition of clathrin-mediated endocytosis (CME) by dominant-negative induction of dynamin-related protein1A and knockout of mu subunit of adaptor protein 2 complex, although the knockout mutants of OsAP2M gene showed dwarf phenotype.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>LOC_Os02g51110.1
ACCTCCCAGTTGCTCAGGCTTCTCAACCTTAGCTAGCTCGATCTCCCTATAAATACTCCTGCTCATTACCACAACGAGCAAGCGATCGACGGAGCGAGCGAGCTAGCCAGCCAGTGTTAGAGCTTGAGCTGCTTGTTCTTCTTCTACCTCCTGCACTCGCGTGCTGCACAAGTAGCTCAGCTAGATAGAGCGTCAGAAATGGCCAGCAACAACTCGAGAACAAACTCCAGGGCGAACTACTCCAACGAGATCCACGATCTCTCCACGGTGCAGAACGGCACCATGCCTACCATGTACTACGGCGAGAAGGCCATCGCCGACTTCTTCCCTCCTCACCTCCTCAAGAAGGTCGTGTCGGAGGTGGTGGCCACGTTCCTGCTGGTGTTCATGACGTGTGGGGCGGCAGGGATCAGCGGCAGCGACCTGTCTCGCATATCGCAGCTGGGACAGTCGATCGCCGGTGGCCTCATCGTGACGGTGATGATCTACGCCGTCGGCCACATCTCCGGCGCCCACATGAACCCCGCCGTGACGCTCGCGTTCGCCGTGTTCAGGCATTTCCCCTGGATTCAGGTTCCGTTCTACTGGGCGGCGCAGTTCACCGGAGCGATATGCGCGTCGTTCGTGCTCAAGGCGGTGATCCACCCGGTGGATGTGATCGGAACCACCACGCCCGTGGGGCCGCACTGGCACTCGCTCGTCGTCGAGGTCATCGTGACGTTCAACATGATGTTCGTCACGCTCGCCGTCGCCACGGACACGAGAGCGGTGGGTGAGTTGGCCGGGTTGGCGGTTGGTTCCGCGGTTTGCATTACGTCCATCTTCGCAGGGGCAATTTCAGGTGGATCGATGAACCCGGCAAGGACGCTGGGGCCGGCGCTGGCGAGCAACAAGTTCGACGGCCTGTGGATCTACTTCCTGGGCCCAGTCATGGGCACGCTCTCGGGAGCATGGACCTACACCTTCATCCGCTTCGAGGACACCCCCAAGGAAGGCTCCTCCCAGAAGCTCTCCTCCTTCAAGCTGCGCCGCTTGCGGAGCCAGCAGTCCATCGCCGCCGACGACGTCGACGAGATGGAGAACATCCAAGTGTGATAGGACGACGAGATGTCGTCGATCGTGTCCTCTTACTCGGAAAATTACCAGTCGATCTCGGTCTCGTCATCACTAGCTACGTCTTTGTGTGTGTTTTGTGTCGTGTCACTGCTGCTTCGTACACGCCGGAGAGAGTTACATAAAACGCGCGCGCGTGCACGGGGGAGTGGCGCTAGCTTTGGTTGCTTGGTGGTTCGTGTGGGGTACGTAGATTGCTCGCTCTGTTAATTCCGGGGCTGGAGCCTGCTAATTTTGGGCGTGTGCGTGTGCCGCTTGTGCATCAGTCTCTGCCGTCAAATTGTGCGTGTGTGCCAGGTGTACTATCTCTCCAGCAGTTGCTTGTTCCACTTCAATTCACCCCCAAAGTAATTAAAAGGATGTCACGTTCTCTCCCCTATATAAAACATCTGCGACTTTATAT

CDS Sequence

>LOC_Os02g51110.1
ATGGCCAGCAACAACTCGAGAACAAACTCCAGGGCGAACTACTCCAACGAGATCCACGATCTCTCCACGGTGCAGAACGGCACCATGCCTACCATGTACTACGGCGAGAAGGCCATCGCCGACTTCTTCCCTCCTCACCTCCTCAAGAAGGTCGTGTCGGAGGTGGTGGCCACGTTCCTGCTGGTGTTCATGACGTGTGGGGCGGCAGGGATCAGCGGCAGCGACCTGTCTCGCATATCGCAGCTGGGACAGTCGATCGCCGGTGGCCTCATCGTGACGGTGATGATCTACGCCGTCGGCCACATCTCCGGCGCCCACATGAACCCCGCCGTGACGCTCGCGTTCGCCGTGTTCAGGCATTTCCCCTGGATTCAGGTTCCGTTCTACTGGGCGGCGCAGTTCACCGGAGCGATATGCGCGTCGTTCGTGCTCAAGGCGGTGATCCACCCGGTGGATGTGATCGGAACCACCACGCCCGTGGGGCCGCACTGGCACTCGCTCGTCGTCGAGGTCATCGTGACGTTCAACATGATGTTCGTCACGCTCGCCGTCGCCACGGACACGAGAGCGGTGGGTGAGTTGGCCGGGTTGGCGGTTGGTTCCGCGGTTTGCATTACGTCCATCTTCGCAGGGGCAATTTCAGGTGGATCGATGAACCCGGCAAGGACGCTGGGGCCGGCGCTGGCGAGCAACAAGTTCGACGGCCTGTGGATCTACTTCCTGGGCCCAGTCATGGGCACGCTCTCGGGAGCATGGACCTACACCTTCATCCGCTTCGAGGACACCCCCAAGGAAGGCTCCTCCCAGAAGCTCTCCTCCTTCAAGCTGCGCCGCTTGCGGAGCCAGCAGTCCATCGCCGCCGACGACGTCGACGAGATGGAGAACATCCAAGTGTGA

Protein Sequence

>LOC_Os02g51110.1
MASNNSRTNSRANYSNEIHDLSTVQNGTMPTMYYGEKAIADFFPPHLLKKVVSEVVATFLLVFMTCGAAGISGSDLSRISQLGQSIAGGLIVTVMIYAVGHISGAHMNPAVTLAFAVFRHFPWIQVPFYWAAQFTGAICASFVLKAVIHPVDVIGTTTPVGPHWHSLVVEVIVTFNMMFVTLAVATDTRAVGELAGLAVGSAVCITSIFAGAISGGSMNPARTLGPALASNKFDGLWIYFLGPVMGTLSGAWTYTFIRFEDTPKEGSSQKLSSFKLRRLRSQQSIAADDVDEMENIQV*