OsMADS6;MFO1

Gene Details

MSU gene ID: LOC_Os02g45770
RAPdb gene ID: Os02g0682200
Gene Symbol: OsMADS6 MFO1 AFG1
Genome: MSU7 , IRGSP-1.0
Species: Oryza sativa

Functional Descriptions

OsMADS6 was initially named as MFO1 for mosaic floral organs based on its moderate mutant phenotypes.
Here, we report a null allele of OsMADS6 (OsMADS6-5), which exhibited a strong mutant phenotype in spikelet without affecting vegetative traits, causing all floral organs except lemma homeotically transformed into lemma-like organs (LLOs) as well as an indeterminate floral meristem, thus resulting in a mutant floret consisting of reiterating whorls of lemma and LLOs.
Here, we describe an AGL6-like gene in rice (Oryza sativa), MOSAIC FLORAL ORGANS1 (MFO1/MADS6), that regulates floral organ identity and floral meristem determinacy.
Furthermore, the determinacy of the floral meristem was lost, and extra carpels or spikelets developed in MFO1 florets.
So far, four moderate or weak mutant alleles of OsMADS6 have been described, providing valuable insights into its role in flower development.
Taken together, our results revealed that OsMADS6 acts as a critical regulator for early flower development in rice and provide novel insights into the molecular mechanism of OsMADS6.
Characterization of OsMADS6-5, a null allele, reveals that OsMADS6 is a critical regulator for early flower development in rice (Oryza sativa L.).
OsMADS17 has been shown to play a minor role in floral development and appears to result from a duplication of OsMADS6.
Here, we show the biological role of the AGL6-like gene, OsMADS6, in specifying floral organ and meristem identities in rice (Oryza sativa L.
OsMADS6 was strongly expressed in the floral meristem at early stages.
Compared to wild type plants, OsMADS6 mutants displayed altered palea identity, extra glume-like or mosaic organs, abnormal carpel development and loss of floral meristem determinacy.
Strikingly, mutation of a SEPALLATA (SEP)-like gene, OsMADS1 (LHS1), enhanced the defect of OsMADS6 flowers, and no inner floral organs or glume-like structures were observed in whorls 2 and 3 of osmads1-z OsMADS6-1 flowers.
Furthermore, the osmads1-z OsMADS6-1 double mutants developed severely indeterminate floral meristems.
Our finding, therefore, suggests that the ancient OsMADS6 gene is able to specify floral state by determining floral organ and meristem identities in monocot crop rice together with OsMADS1.
The AGL6-like gene OsMADS6 regulates floral organ and meristem identities in rice.
Subsequently, OsMADS6 transcripts were mainly detectable in paleas, lodicules, carpels and the integument of ovule, as well as in the receptacle.
Further investigation shows that ADP-glucose pyrophosphorylase genes, encoding the rate-limiting step enzyme in the starch synthesis pathway, are subject to the regulation of OsMADS6.
Auxin-responsive OsMGH3, a common downstream target of OsMADS1 and OsMADS6, controls rice floret fertility.
In the flower of MFO1 mutants, the identities of palea and lodicule are disturbed, and mosaic organs were observed.
Whereas single mutants in either MFO1 or the SEPALLATA-like gene LHS1 showed moderate phenotypes, the MFO1 lhs1 double mutant showed a severe phenotype, including the loss of spikelet meristem determinacy.
OsMGH3/OsGH3-8 is expressed abundantly in rice florets and is regulated by two related and redundant transcription factors, OsMADS1 and OsMADS6, but its contribution to flower development is not known.
In consistently, over-expression of OsMADS6 led to additional lodicule-, stamen- and carpel-like organs.
Expression analysis showed that OsMADS6 controls the formation of the incipient primordia of lodicule, stamen and carpel via regulating the expression of class B, C and SEP-like MADS-box genes.
Here, we report that OsMADS6 is highly expressed in flower and endosperm in Oryza sativa (rice).
OsMADS6 plays an essential role in endosperm nutrient accumulation and is subject to epigenetic regulation in rice (Oryza sativa).
However, in contrast to other OsMADS6 alleles, the afg1 mutant showed altered grain size and grain quality, with decreased total starch and amylose contents, and increased protein and soluble sugar contents.
The analysis of transcriptional activity suggested that AFG1 is a transcriptional activator and may affect grain size by regulating the expression levels of several genes related to cell expansion and proliferation in the AFG1 mutant.
These results revealed that AFG1 plays an important role in determining palea identity and affecting grain yield and quality in rice.
Similar to previously characterized OsMADS6 alleles, in the afg1 floret, the palea lost its marginal region and acquired the lemma identity.
We show here that the rice homeotic transcription factor OsMADS32 regulates floral patterning by interacting synergistically with E class protein OsMADS6 in a dosage-dependent manner.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>LOC_Os02g45770.1
ATATTCTCGTCATCATTGGAGGCTTTAGCAAGCAAGAAGAGAGGCAGTGGTGGTGGTGGTGGAGGAGGAGCTAGCTAGCCTGTGCTTGCTGATCGGTGCTGAGCTGAGGAATCGTTCGATCGATCGGGCGAGATGGGGAGGGGAAGAGTTGAGCTGAAGCGCATCGAGAACAAGATCAACAGGCAGGTCACCTTCTCCAAGCGCCGCAACGGCCTCCTCAAGAAGGCCTACGAGCTGTCCGTTCTCTGCGACGCCGAGGTCGCGCTCATCATCTTCTCCAGCCGCGGCAAGCTCTACGAGTTCGGCAGCGCCGGCATAACAAAGACTTTAGAAAGGTACCAACATTGTTGCTACAATGCTCAAGATTCCAACAATGCACTTTCTGAAACCCAGAGTTGGTACCATGAAATGTCAAAGTTGAAAGCAAAATTTGAAGCTTTGCAGCGCACTCAAAGGCACTTGCTTGGGGAGGATCTTGGACCACTCAGCGTCAAAGAATTGCAGCAGCTGGAGAAACAGCTTGAATGTGCACTATCACAGGCGAGACAGAGAAAGACGCAACTGATGATGGAACAAGTGGAGGAACTTCGCAGAAAGGAGCGTCAGCTGGGTGAAATTAATAGGCAACTCAAGCACAAGCTCGAGGTTGAAGGTTCCACCAGCAACTACAGAGCCATGCAGCAAGCCTCCTGGGCTCAGGGCGCCGTGGTGGAGAATGGCGCCGCATACGTGCAGCCGCCGCCACACTCCGCGGCCATGGACTCTGAACCCACCTTGCAAATTGGGTATCCTCATCAATTTGTGCCTGCTGAAGCAAACACTATTCAGAGGAGCACTGCCCCTGCAGGTGCAGAGAACAACTTCATGCTGGGATGGGTTCTTTGAGCTAAGCAGCCATCGATCAGCTGTCAGAAGTTGGAGCTAATAATAAAAGGGATGTGGAGTGGGCTACATGTATCTCGGATCTCTCTGCGAGCCACCTAATGGTCTTGCGTGGCCCTTTAATCTGTATGTTTTTGTGTGTAAGCTACTGCTAGCTGTTTGCACCTTCTGCGTCCGTGGTTGTGTTTCCGTGCTACCTTTTTATGTTTTGATTTGGATCTTGTTTGAAAATAATCTTACCAGCTTTGGGTAAACTGTTTATTACGTACTCTATATAGCATATGTGACCGACGACAACGGTTTCATTTTAGATGATGTGTATGGATGATTTCTTTCCAAAATCACATCTTTAGTATAAGAGCAATTTTACCATCCAATACCAAA

CDS Sequence

>LOC_Os02g45770.1
ATGGGGAGGGGAAGAGTTGAGCTGAAGCGCATCGAGAACAAGATCAACAGGCAGGTCACCTTCTCCAAGCGCCGCAACGGCCTCCTCAAGAAGGCCTACGAGCTGTCCGTTCTCTGCGACGCCGAGGTCGCGCTCATCATCTTCTCCAGCCGCGGCAAGCTCTACGAGTTCGGCAGCGCCGGCATAACAAAGACTTTAGAAAGGTACCAACATTGTTGCTACAATGCTCAAGATTCCAACAATGCACTTTCTGAAACCCAGAGTTGGTACCATGAAATGTCAAAGTTGAAAGCAAAATTTGAAGCTTTGCAGCGCACTCAAAGGCACTTGCTTGGGGAGGATCTTGGACCACTCAGCGTCAAAGAATTGCAGCAGCTGGAGAAACAGCTTGAATGTGCACTATCACAGGCGAGACAGAGAAAGACGCAACTGATGATGGAACAAGTGGAGGAACTTCGCAGAAAGGAGCGTCAGCTGGGTGAAATTAATAGGCAACTCAAGCACAAGCTCGAGGTTGAAGGTTCCACCAGCAACTACAGAGCCATGCAGCAAGCCTCCTGGGCTCAGGGCGCCGTGGTGGAGAATGGCGCCGCATACGTGCAGCCGCCGCCACACTCCGCGGCCATGGACTCTGAACCCACCTTGCAAATTGGGTATCCTCATCAATTTGTGCCTGCTGAAGCAAACACTATTCAGAGGAGCACTGCCCCTGCAGGTGCAGAGAACAACTTCATGCTGGGATGGGTTCTTTGA

Protein Sequence

>LOC_Os02g45770.1
MGRGRVELKRIENKINRQVTFSKRRNGLLKKAYELSVLCDAEVALIIFSSRGKLYEFGSAGITKTLERYQHCCYNAQDSNNALSETQSWYHEMSKLKAKFEALQRTQRHLLGEDLGPLSVKELQQLEKQLECALSQARQRKTQLMMEQVEELRRKERQLGEINRQLKHKLEVEGSTSNYRAMQQASWAQGAVVENGAAYVQPPPHSAAMDSEPTLQIGYPHQFVPAEANTIQRSTAPAGAENNFMLGWVL*