Gene Details:
- MSU gene ID: LOC_Os02g35329
- RAPdb gene ID: Os02g0559800
- Gene Symbol: EL5
- Genome: MSU7 , IRGSP-1.0
- Species: Oryza sativa
Functional Descriptions:
- These results strongly suggest that EL5 and OsUBC5b have roles in plant defense response through the turnover of protein(s) via the ubiquitin/proteasome system.
- Plants expressing EL5C153A and EL5W165A, which encode an inactive E3, showed a rootless phenotype accompanied by cell death in root primordia, and those expressing EL5V162A, with moderately impaired E3 activity, formed short crown roots with necrotic lateral roots.
- We hypothesize that EL5 might be responsible for mediating the degradation of cytotoxic proteins produced in root cells after the actions of phytohormones.
- The dominant-negative phenotype was specifically observed in root meristems where EL5 is expressed, and not recovered by exogenous auxin.
- Deletion of the transmembrane domain prevented the EL5 from localizing in the membrane and from exerting an inhibitory effect on root formation.
- We concluded that EL5 plays a major role as a membrane-anchored E3 for the maintenance of cell viability after the initiation of root primordial formation.
- RING-H2 type ubiquitin ligase EL5 is involved in root development through the maintenance of cell viability in rice.
- Recent analyses revealed that EL5 plays a crucial role as an E3 in the maintenance of cell viability during root development in rice.
- EL5 is involved in root development as an anti-cell death ubiquitin ligase.
- The structural specificity of the elicitor required for the expression of EL5 was consistent with other defense reactions observed in the experimental system, indicating that the elicitor signal to EL5 is transmitted through a single class of receptor-mediated recognition events.
- We also discuss the possible role of EL5 as an anti-cell death enzyme.
- Rice ubiquitin ligase EL5 prevents root meristematic cell death under high nitrogen conditions and interacts with a cytosolic GAPDH.
- Root formation in rice transformants overexpressing mutated EL5 (mEL5) was severely inhibited because of meristematic cell death.
- These results indicate that impairment of EL5 function activates nitrogen signaling despite the absence of a nitrogen source.
Function-related keywords:
- defense-response , cell-death , phytohormone , root , root-development , meristem , defense , lateral-root , auxin , crown , crown-root , nitrogen , Ubiquitin
Literature:
- Isolation and analysis of expression mechanisms of a rice gene, EL5, which shows structural similarity to ATL family from Arabidopsis, in response to N-acetylchitooligosaccharide elicitor . DOI: 10.1016/s0168-9452(00)00390-3 ; PMID: 11448732
- EL5, a rice N-acetylchitooligosaccharide elicitor-responsive RING-H2 finger protein, is a ubiquitin ligase which functions in vitro in co-operation with an elicitor-responsive ubiquitin-conjugating enzyme, OsUBC5b . DOI: 10.1046/j.1365-313x.2002.01299.x ; PMID: 12028574
- RING-H2 type ubiquitin ligase EL5 is involved in root development through the maintenance of cell viability in rice . DOI: 10.1111/j.1365-313X.2007.03120.x ; PMID: 17559513
- EL5 is involved in root development as an anti-cell death ubiquitin ligase . DOI: 10.4161/psb.3.2.5081 ; PMID: 19704739
- Rice ubiquitin ligase EL5 prevents root meristematic cell death under high nitrogen conditions and interacts with a cytosolic GAPDH . DOI: 10.4161/15592324.2014.990801 ; PMID: 25807209
Related News:
Gene Resources:
- NCBI ID: AB045120
- UniProt accessions:
Sequences:
cDNA Sequence
- >LOC_Os02g35329.1
GTCGATTATTATGGTGCGGGGTGTCGAGCAGGGCGGCCCCGCCATGGACGAGTCTTCGTCGTCGTCGTCGCCGTCGCCGGTGTCCGCGCCTGCAGGGCAGGCAGCCATGACGGCCGGCGGCATCGCCACCGTGGCGGCCGTGCTCATCGTCTTCGCGGCGCTCACGCTCGCCTTCGTCCTGCTCCAGTGCTACTGCGACGAGCGGCGCCGCGCCGTGACGACGACGTCGACGAGCGGGCGCGGGCGGCGGCCGCGGCCGCGGCGGCGCTCTGGGAGCGGCGGGGACGGTGGAACGGGAGGAGGGGTCGACCCGGAGGTGCTCCGGTCGCTGCCGGTCACGGTGTACAGCCGCAGCACGGCGGCGGCGGCGGCGAAGGAGGAGGAGGAGGAGGACGACGACGGCGTCGAGTGCGCGGTGTGCCTCGCGGAGCTCGAGGACGGCGAGGAGGCCAGGTTCCTCCCCCGGTGCGGCCACGGCTTCCACGCCGAGTGCGTCGACATGTGGCTCGGCTCCCACTCCACCTGCCCGCTCTGCCGCCTCACCGTCGTCGTGCCGCCGCCGCCTCTTCCTCCCGTCCCGCCGGAGCCGCCGGCGAGCTACACCGTGAGCCTCCCGGCGAGCGTCCTGCTCGGCCTGTCCGACCATGGCGCCGGCGCGGTGACCATGACAGCGGAGGGCCGCAGCACGCTGGTGATCGAGATCCCCGAATCCGCGGCTTCGACGACCCCGCGCGACGCGGCGGCGAGGTCGTCGCCGAGCTTGGCGCGGCTGAGGTCACTGAGAAGGCTCTGGAGCTTCGGGCGGCAAGGGGCGGCGGGGTCGACGTCGTCATGCTCCTGCGCCACCGGAGGAGACAACGACGACGGCGACGTCGAGCACGGTGTCAGCGTCACCGTCGCCATCCGCGCCGTGGAGGCGGCAACGCCGGCACGGCCACCGGAGGCCGAGGCCGGTGCAAGAACCGCCGCCGCGCATGTCCGGAATTGACGGCGGCGAGGTCGTCAAGTATTATAAGGCGATCTCCCTGTACATATCGGTAGAACCGAACTGGAATCGCCATTAATTCCTACGATTTTAGAAAATATCAATTTCATTTTTAAGATTAGAAACATTTAAGTAGAAATTATTTGTTCATCAGTCAAGTAGCAAAGAGAAATGTATGGATGGCAGTGAGAAGCATCCCTCTCCGTATGTTCC
CDS Sequence
- >LOC_Os02g35329.1
ATGGTGCGGGGTGTCGAGCAGGGCGGCCCCGCCATGGACGAGTCTTCGTCGTCGTCGTCGCCGTCGCCGGTGTCCGCGCCTGCAGGGCAGGCAGCCATGACGGCCGGCGGCATCGCCACCGTGGCGGCCGTGCTCATCGTCTTCGCGGCGCTCACGCTCGCCTTCGTCCTGCTCCAGTGCTACTGCGACGAGCGGCGCCGCGCCGTGACGACGACGTCGACGAGCGGGCGCGGGCGGCGGCCGCGGCCGCGGCGGCGCTCTGGGAGCGGCGGGGACGGTGGAACGGGAGGAGGGGTCGACCCGGAGGTGCTCCGGTCGCTGCCGGTCACGGTGTACAGCCGCAGCACGGCGGCGGCGGCGGCGAAGGAGGAGGAGGAGGAGGACGACGACGGCGTCGAGTGCGCGGTGTGCCTCGCGGAGCTCGAGGACGGCGAGGAGGCCAGGTTCCTCCCCCGGTGCGGCCACGGCTTCCACGCCGAGTGCGTCGACATGTGGCTCGGCTCCCACTCCACCTGCCCGCTCTGCCGCCTCACCGTCGTCGTGCCGCCGCCGCCTCTTCCTCCCGTCCCGCCGGAGCCGCCGGCGAGCTACACCGTGAGCCTCCCGGCGAGCGTCCTGCTCGGCCTGTCCGACCATGGCGCCGGCGCGGTGACCATGACAGCGGAGGGCCGCAGCACGCTGGTGATCGAGATCCCCGAATCCGCGGCTTCGACGACCCCGCGCGACGCGGCGGCGAGGTCGTCGCCGAGCTTGGCGCGGCTGAGGTCACTGAGAAGGCTCTGGAGCTTCGGGCGGCAAGGGGCGGCGGGGTCGACGTCGTCATGCTCCTGCGCCACCGGAGGAGACAACGACGACGGCGACGTCGAGCACGGTGTCAGCGTCACCGTCGCCATCCGCGCCGTGGAGGCGGCAACGCCGGCACGGCCACCGGAGGCCGAGGCCGGTGCAAGAACCGCCGCCGCGCATGTCCGGAATTGA
Protein Sequence
- >LOC_Os02g35329.1
MVRGVEQGGPAMDESSSSSSPSPVSAPAGQAAMTAGGIATVAAVLIVFAALTLAFVLLQCYCDERRRAVTTTSTSGRGRRPRPRRRSGSGGDGGTGGGVDPEVLRSLPVTVYSRSTAAAAAKEEEEEDDDGVECAVCLAELEDGEEARFLPRCGHGFHAECVDMWLGSHSTCPLCRLTVVVPPPPLPPVPPEPPASYTVSLPASVLLGLSDHGAGAVTMTAEGRSTLVIEIPESAASTTPRDAAARSSPSLARLRSLRRLWSFGRQGAAGSTSSCSCATGGDNDDGDVEHGVSVTVAIRAVEAATPARPPEAEAGARTAAAHVRN*