Information report for sd1;GA20ox2
Gene Details
|
|
Functional Descriptions
- The suppressive function of OsSPY in GA signaling was supported by the findings that the dwarfism was partially rescued and OsGA20ox2 (GA20 oxidase) expression was reduced in GA-deficient and GA-insensitive mutants by the knockdown of OsSPY function.
- Moreover, overexpression of SLRL1 in normal rice plants induced a dwarf phenotype with an increased level of OsGA20ox2 gene expression and diminished the GA-induced shoot elongation, suggesting that SLRL1 acts as a repressor of GA signaling.
- Furthermore, OsGSR1 RNAi plants show a reduced sensitivity to GA treatment, an increased expression of the GA biosynthetic gene OsGA20ox2, which is feedback inhibited by GA signaling, and an elevated level of endogenous GA: together, these suggest that OsGSR1 is a positive regulator of GA signaling.
- ), OsGA20ox2 ( SD1 ), is well known as the Green Revolution gene, and loss-of function mutation in this locus causes semi-dwarfism.
- The short stature of IR8 is due to a mutation in the plant’s sd1 gene, and here we identify this gene as encoding an oxidase enzyme involved in the biosynthesis of gibberellin, a plant growth hormone.
- The expression levels of gibberellin (GA) biosynthetic genes including OsCPS1, OsKS1, OsKO1, OsKAO, OsGA20ox2/SD1 and OsGA2ox3 were significantly increased in d62 mutant.
- In this report, we show that a rice (Oryza sativa) YABBY1 (YAB1) gene had a similar expression pattern as key rice GA biosynthetic genes GA3ox2 and GA20ox2.
- Control of grain protein contents through SEMIDWARF1 mutant alleles: sd1 increases the grain protein content in Dee-geo-woo-gen but not in Reimei.
- When submerged, plants carrying the deepwater rice-specific sd1 haplotype amplify a signaling relay in which the sd1 gene is transcriptionally activated by an ethylene-responsive transcription factor, OsEIL1a.
- Here, we identify the gibberellin biosynthesis gene, sd1 (SEMIDWARF1), whose loss-of-function allele catapulted the rice Green Revolution, as being responsible for submergence-induced internode elongation.
- Here, physical separation of two defects allows recombination to generate the wild-type sd1 gene, for which plant height can then be used as a reporter.
- The loss of function of OsGA20ox2 and OsFBX267 in WP-22-2 resulted in reduced plant height as well as early flowering, and the same has been confirmed by editing OsGA20ox2 in the rice variety Pusa Basmati1 (PB1) using the CRISPR-Cas9 approach.
- The targeted editing of OsGA20ox2 in PB1 conferred shorter plant height to the edited lines compared with the wild type.
Functional Keywords
Literature and News
- Identification and characterization of dwarf 62, a loss-of-function mutation in DLT/OsGRAS-32 affecting gibberellin metabolism in rice . DOI: 10.1007/s00425-010-1263-1 ; PMID: 20830595
- A role of OsGA20ox1 , encoding an isoform of gibberellin 20-oxidase, for regulation of plant stature in rice . DOI: 10.1007/s11103-004-1692-y ; PMID: 15604710
- Green revolution: a mutant gibberellin-synthesis gene in rice . DOI: 10.1038/416701a ; PMID: 11961544
- Overexpression of a GRAS protein lacking the DELLA domain confers altered gibberellin responses in rice . DOI: 10.1111/j.1365-313X.2005.02562.x ; PMID: 16262715
- The rice SPINDLY gene functions as a negative regulator of gibberellin signaling by controlling the suppressive function of the DELLA protein, SLR1, and modulating brassinosteroid synthesis . DOI: 10.1111/j.1365-313X.2006.02875.x ; PMID: 17052323
- OsGSR1 is involved in crosstalk between gibberellins and brassinosteroids in rice . DOI: 10.1111/j.1365-313X.2008.03707.x ; PMID: 18980660
- The rice YABBY1 gene is involved in the feedback regulation of gibberellin metabolism . DOI: 10.1104/pp.107.096586 ; PMID: 17369428
- Control of grain protein contents through SEMIDWARF1 mutant alleles: sd1 increases the grain protein content in Dee-geo-woo-gen but not in Reimei . DOI: 10.1007/s00438-014-0965-7 ; PMID: 25492221
- Intragenic recombination between two non-functional semi-dwarf 1 alleles produced a functional SD1 allele in a tall recombinant inbred line in rice . DOI: 10.1371/journal.pone.0190116 ; PMID: 29281725
- Ethylene-gibberellin signaling underlies adaptation of rice to periodic flooding . DOI: 10.1126/science.aat1577 ; PMID: 30002253
- High-resolution insight into recombination events at the SD1 locus in rice . DOI: 10.1111/tpj.14154 ; PMID: 30417595
- Generation of semi-dwarf rice (Oryza sativa L.) lines by CRISPR/Cas9-directed mutagenesis of OsGA20ox2 and proteomic analysis of unveiled changes caused by mutations . DOI: 10.1007/s13205-019-1919-x ; PMID: 31656725
- Loss of Function of OsFBX267 and OsGA20ox2 in Rice Promotes Early Maturing and Semi-Dwarfism in γ-Irradiated IWP and Genome-Edited Pusa Basmati-1 . DOI: 10.3389/fpls.2021.714066 ; PMID: 34630462
- NA .
- NA .
Gene Resources
- UniProt: B6F2D9
- EMBL: AB469068, AB538265, AB538266
- AlphaFoldDB: B6F2D9
- EnsemblPlants: Os01t0883800-02
- Gramene: Os01t0883800-02
- KEGG: dosa:Os01g0883800
- Orthologous matrix: FCDAMNG
Sequences
cDNA Sequence
- >LOC_Os01g66100.1
CTGCACACACACACACACTCACACTCACACACGCTCTCAACTCACTCCCGCTCAACACAGCGCTCACTTCTCATCTCCAATCTCATGGTGGCCGAGCACCCCACGCCACCACAGCCGCACCAACCACCGCCCATGGACTCCACCGCCGGCTCTGGCATTGCCGCCCCGGCGGCGGCGGCGGTGTGCGACCTGAGGATGGAGCCCAAGATCCCGGAGCCATTCGTGTGGCCGAACGGCGACGCGAGGCCGGCGTCGGCGGCGGAGCTGGACATGCCCGTGGTCGACGTGGGCGTGCTCCGCGACGGCGACGCCGAGGGGCTGCGCCGCGCCGCGGCGCAGGTGGCCGCCGCGTGCGCCACGCACGGGTTCTTCCAGGTGTCCGAGCACGGCGTCGACGCCGCTCTGGCGCGCGCCGCGCTCGACGGCGCCAGCGACTTCTTCCGCCTCCCGCTCGCCGAGAAGCGCCGCGCGCGCCGCGTCCCGGGCACCGTGTCCGGCTACACCAGCGCCCACGCCGACCGCTTCGCCTCCAAGCTCCCATGGAAGGAGACCCTCTCCTTCGGCTTCCACGACCGCGCCGCCGCCCCCGTCGTCGCCGACTACTTCTCCAGCACCCTCGGCCCCGACTTCGCGCCAATGGGGAGGGTGTACCAGAAGTACTGCGAGGAGATGAAGGAGCTGTCGCTGACGATCATGGAACTCCTGGAGCTGAGCCTGGGCGTGGAGCGAGGCTACTACAGGGAGTTCTTCGCGGACAGCAGCTCAATCATGCGGTGCAACTACTACCCGCCATGCCCGGAGCCGGAGCGGACGCTCGGCACGGGCCCGCACTGCGACCCCACCGCCCTCACCATCCTCCTCCAGGACGACGTCGGCGGCCTCGAGGTCCTCGTCGACGGCGAATGGCGCCCCGTCAGCCCCGTCCCCGGCGCCATGGTCATCAACATCGGCGACACCTTCATGGCGCTGTCGAACGGGAGGTATAAGAGCTGCCTGCACAGGGCGGTGGTGAACCAGCGGCGGGAGCGGCGGTCGCTGGCGTTCTTCCTGTGCCCGCGGGAGGACAGGGTGGTGCGGCCGCCGCCGAGCGCCGCCACGCCGCAGCACTACCCGGACTTCACCTGGGCCGACCTCATGCGCTTCACGCAGCGCCACTACCGCGCCGACACCCGCACGCTCGACGCCTTCACGCGCTGGCTCGCGCCGCCGGCCGCCGACGCCGCCGCGACGGCGCAGGTCGAGGCGGCCAGCTGATCGCCGAACGGAACGAAACGGAACGAACAGAAGCCGATTTTTGGCGGGGCCCACGCCCACGTGAGGCCCCACGTGGACAGTGGGCCCGGGCGGAGGTGGCACCCACGTGGACCGCGGGCCCCGCGCCGCCTTCCAATTTTGGACCCTACCGCTGTACATATTCATATATTGCAAGAAGAAGCAAAACGTACGTGTGGGTTGGGTTGGGCTTCTCTCTATTACTAAAAAAAATATAATGGAACGACGGATGAATGGATGCTTATTTATTTATCTAAATTGAATTCGAATTCGGCTCA
CDS Sequence
- >LOC_Os01g66100.1
ATGGTGGCCGAGCACCCCACGCCACCACAGCCGCACCAACCACCGCCCATGGACTCCACCGCCGGCTCTGGCATTGCCGCCCCGGCGGCGGCGGCGGTGTGCGACCTGAGGATGGAGCCCAAGATCCCGGAGCCATTCGTGTGGCCGAACGGCGACGCGAGGCCGGCGTCGGCGGCGGAGCTGGACATGCCCGTGGTCGACGTGGGCGTGCTCCGCGACGGCGACGCCGAGGGGCTGCGCCGCGCCGCGGCGCAGGTGGCCGCCGCGTGCGCCACGCACGGGTTCTTCCAGGTGTCCGAGCACGGCGTCGACGCCGCTCTGGCGCGCGCCGCGCTCGACGGCGCCAGCGACTTCTTCCGCCTCCCGCTCGCCGAGAAGCGCCGCGCGCGCCGCGTCCCGGGCACCGTGTCCGGCTACACCAGCGCCCACGCCGACCGCTTCGCCTCCAAGCTCCCATGGAAGGAGACCCTCTCCTTCGGCTTCCACGACCGCGCCGCCGCCCCCGTCGTCGCCGACTACTTCTCCAGCACCCTCGGCCCCGACTTCGCGCCAATGGGGAGGGTGTACCAGAAGTACTGCGAGGAGATGAAGGAGCTGTCGCTGACGATCATGGAACTCCTGGAGCTGAGCCTGGGCGTGGAGCGAGGCTACTACAGGGAGTTCTTCGCGGACAGCAGCTCAATCATGCGGTGCAACTACTACCCGCCATGCCCGGAGCCGGAGCGGACGCTCGGCACGGGCCCGCACTGCGACCCCACCGCCCTCACCATCCTCCTCCAGGACGACGTCGGCGGCCTCGAGGTCCTCGTCGACGGCGAATGGCGCCCCGTCAGCCCCGTCCCCGGCGCCATGGTCATCAACATCGGCGACACCTTCATGGCGCTGTCGAACGGGAGGTATAAGAGCTGCCTGCACAGGGCGGTGGTGAACCAGCGGCGGGAGCGGCGGTCGCTGGCGTTCTTCCTGTGCCCGCGGGAGGACAGGGTGGTGCGGCCGCCGCCGAGCGCCGCCACGCCGCAGCACTACCCGGACTTCACCTGGGCCGACCTCATGCGCTTCACGCAGCGCCACTACCGCGCCGACACCCGCACGCTCGACGCCTTCACGCGCTGGCTCGCGCCGCCGGCCGCCGACGCCGCCGCGACGGCGCAGGTCGAGGCGGCCAGCTGA
Protein Sequence
- >LOC_Os01g66100.1
MVAEHPTPPQPHQPPPMDSTAGSGIAAPAAAAVCDLRMEPKIPEPFVWPNGDARPASAAELDMPVVDVGVLRDGDAEGLRRAAAQVAAACATHGFFQVSEHGVDAALARAALDGASDFFRLPLAEKRRARRVPGTVSGYTSAHADRFASKLPWKETLSFGFHDRAAAPVVADYFSSTLGPDFAPMGRVYQKYCEEMKELSLTIMELLELSLGVERGYYREFFADSSSIMRCNYYPPCPEPERTLGTGPHCDPTALTILLQDDVGGLEVLVDGEWRPVSPVPGAMVINIGDTFMALSNGRYKSCLHRAVVNQRRERRSLAFFLCPREDRVVRPPPSAATPQHYPDFTWADLMRFTQRHYRADTRTLDAFTRWLAPPAADAAATAQVEAAS*