Gene Details:
- Gene ID:
- Gene Symbol: CYP716A175
- Gene Name: cytochrome P450
- Genome: Golden ASM211411v1
- Species: Malus domestica
Functional Descriptions:
- We used a homology-based approach to identify and functionally characterize two new oxidosqualene cyclases (MdOSC4 and MdOSC5) and one cytochrome P450 (CYP716A175).
- CYP716A175 catalyses the C-28 oxidation of α-amyrin, β-amyrin, lupeol and germanicol, producing ursolic acid, oleanolic acid, betulinic acid, and putatively morolic acid.
- CYP716A175 catalyses the three-step oxidation of triterpene backbones at the C-28 position.
- CYP716A175 encodes a protein of 484 amino acids and is located in linkage group 13 (LG13) in the genome. An alignment of CYP716A175 with putative C-28 triterpene hydroxylases from other species is shown in Fig. S5 and shows that CYP716A175 is clearly grouped with the CYP716A subfamily.
Function-related keywords:
Literature:
- Multifunctional oxidosqualene cyclases and cytochrome P450 involved in the biosynthesis of apple fruit triterpenic acids. DOI: 10.1111/nph.13996 ; PMID: 27214242
Related News:
Gene Resources:
- NCBI ID: EB148173
- UniProt accessions:
Sequences:
cDNA Sequence
- >EB148173.1
ACTCAAGGCACGTTCCTCGCTTCTTAAACAACAACAAAATGGAGCACTTCTATCTGACCCTCCTCTTAGGGTTTGTCTCCTTCATCACTCTTTCTCTCTCCGTGCTCTTTTACCGGCACAGAACGCAGCTCGTCGGCACCAACCTGCCGCCTGGCAAAGTTGGTTACCCAGTGATCGGCGAGACCTACCAGTTCCTAGCCACAGGATGGAAAGGTCACCCGGAGAAATTCATCTTCGACCGCATGACCAAGTACTCCTCCGAAGTGTTCAAGACCTCACTCATGGGCGAGAAGGCCGCCATCTTCTGCGGTGCAGCCTGCAACAAGTTCTTGTTCTCCAACGAGAACAAGCTCGTCACTGCATGGTGGCCCAGCTCAGTCAACAAGGTCTTCCCTTCTTCTTTGGAGACTTCTGCCA
CDS Sequence
Protein Sequence