Gene Details:
- Gene ID: GH_D08G0109
- Gene Symbol: GoSTR
- Gene Name: Gossypium Stem Trichome Repressor
- Genome: TM1_NBI
- Species: Gossypium hirsutum
Functional Descriptions:
- GoSTR, a negative modulator of stem trichome formation in cotton.
- GoSTR functions as a master repressor for stem trichome formation, which was isolated by map-based cloning based on a large F2 segregating population derived from a cross between TM-1 (pubescent stem) and J220 (smooth stem).
- Silencing of GoSTR in J220 and Hai7124 via virus-induced gene silencing resulted in the pubescent stems but no visible change in leaf trichomes, suggesting stem trichomes and leaf trichomes are genetically distinct.
- These results indicate that GoSTR functions as an essential negative modulator of stem trichomes and its transcripts will greatly repress trichome cell differentiation and growth.
Function-related keywords:
Literature:
- GoSTR, a negative modulator of stem trichome formation in cotton. DOI: 10.1111/tpj.16379 ; PMID: 37403589
Related News:
Gene Resources:
Sequences:
cDNA Sequence
CDS Sequence
- >GH_D08G0109
ATGTCAGTTTCTCCCCAGGAAATATCGCCAGAAAACTCATGCTTGTCTTCGGAACCCGGAGATGAAAAGGAGGAGTCGGAGTCGGTGGTGACGATGCGGTGCCGTCCTGAAGTAACGTCGATGCTGCTAGTGGGATGTCCTCGTTGTCTCATGTATGTTATGTTATCCAAAGTTGAACCTAAATGCCCTAAATGTAAGAGCACTGTCTTGCTTGATTTTCTTGATGAAGAGACTGCTAAATGGGCAAGCAATTGA
Protein Sequence
- >GH_D08G0109
ATGTCAGTTTCTCCCCAGGAAATATCGCCAGAAAACTCATGCTTGTCTTCGGAACCCGGAGATGAAAAGGAGGAGTCGGAGTCGGTGGTGACGATGCGGTGCCGTCCTGAAGTAACGTCGATGCTGCTAGTGGGATGTCCTCGTTGTCTCATGTATGTTATGTTATCCAAAGTTGAACCTAAATGCCCTAAATGTAAGAGCACTGTCTTGCTTGATTTTCTTGATGAAGAGACTGCTAAATGGGCAAGCAATTGA