Gene Details:
- Gene ID: GH_D09G0714
- Gene Symbol: GhADF6
- Gene Name: actin depolymerizing factor 6
- Genome: TM1_NBI
- Species: Gossypium hirsutum
Functional Descriptions:
- GhADF6-mediated actin reorganization is associated with defence against Verticillium dahliae infection in cotton.
- GhADF6 binds to actin filaments and possesses actin severing and depolymerizing activities in vitro and in vivo.
- By virus-induced gene silencing analysis, the down-regulation of GhADF6 expression rendered the cotton plants tolerant to V. dahliae infection.
- GhADF6 is an active actin depolymerizing and severing protein. The defence-related down-regulation of GhADF6 was found to augment the abundance of actin filaments and bundles, which was accompanied by enhanced disease tolerance against V. dahliae in cotton.
- Our findings demonstrate that the actin cytoskeleton was reorganized and F-actin abundance was increased on V. dahliae attack. Furthermore, regulating the expression of GhADF6 was identified to be crucial for this cellular process.
Function-related keywords:
- disease , tolerance , defence , actin-protein , cellular-activities , virus , protein
Literature:
- GhADF6-mediated actin reorganization is associated with defence against Verticillium dahliae infection in cotton. DOI: 10.1111/mpp.13137 ; PMID: 34515397
Related News:
Gene Resources:
Sequences:
cDNA Sequence
CDS Sequence
- >GH_D09G0714
ATGTCTTTTAGAGGAGGAAATGCATCGTCGGGCATGGGAGTGGCTGAACACAGCAAAAGCACGTACCTGGAACTGCAGAGGAAGAAGGTGTTCCGATATGTTATCTTCAAGATTGATGAGAAGAAAAAGGAGGTCATAGTTGAAAAGATTGGAGGTCCGACAGAGAGCTATGATGATTTCGCAGCCTCATTGCCGGAGAGTGATTGCCGCTATGCAGTTTATGACTTCGATTTTGTGACTTCCGAGAATTGTCAGAAGAGCAAGATCTTTTTTATTGCATGGTCTCCTTCTGTTTCGAGGATCCGTTCCAAGATGCTCTATGCAACATCAAAGGACAGGTTCCGAAGGGAATTGGAGGGCATCCATTACGAAATCCAGGCAACCGACCCGACTGAAATGGATCTCGAGGTGATTAGGGAGCGTGCACATTAA
Protein Sequence
- >GH_D09G0714
ATGTCTTTTAGAGGAGGAAATGCATCGTCGGGCATGGGAGTGGCTGAACACAGCAAAAGCACGTACCTGGAACTGCAGAGGAAGAAGGTGTTCCGATATGTTATCTTCAAGATTGATGAGAAGAAAAAGGAGGTCATAGTTGAAAAGATTGGAGGTCCGACAGAGAGCTATGATGATTTCGCAGCCTCATTGCCGGAGAGTGATTGCCGCTATGCAGTTTATGACTTCGATTTTGTGACTTCCGAGAATTGTCAGAAGAGCAAGATCTTTTTTATTGCATGGTCTCCTTCTGTTTCGAGGATCCGTTCCAAGATGCTCTATGCAACATCAAAGGACAGGTTCCGAAGGGAATTGGAGGGCATCCATTACGAAATCCAGGCAACCGACCCGACTGAAATGGATCTCGAGGTGATTAGGGAGCGTGCACATTAA