Gene Details:
- Gene ID: Glyma.19G203300
- Gene Symbol: RPS28
- Gene Name: 40S RIBOSOMAL PROTEIN SMALL SUBUNIT S28
- Genome: Wm82.a4.v1
- Species: Glycine max
Functional Descriptions:
- Our results indicate the potential of RPS28 and EIF1 promoters to facilitate future genetic engineering and breeding to improve the quality and yield of soybean, as well as in a wide variety of other plant species.
- Two FLOWERING LOCUS T (FT) homologs, FT2a and FT5a, have been identified as encoding components of florigen and controlling flowering time in soybean . The expression levels of these two genes are down-regulated by E1, E2, E3, and E4 under long-day (LD) conditions, suggesting that FT2a and FT5a are the major soybean flowering regulation targets . Subsequent studies have shown that E9 is FT2a, with a Ty1/copia-like retrotransposon SORE-1 inserted in its first intron in its recessive allele.
- Characterization of two constitutive promoters RPS28 and EIF1 for studying soybean growth, development, and symbiotic nodule development.
- Determined that RPS28 and EIF1 were highly expressed during soybean growth and development, nodule development, and various biotic and abiotic stresses.
- Fusion of both RPS28 and EIF1 promoters, with or without their first intron, with the reporter gene β-GLUCURONIDASE (uidA) in transgenic soybean, resulted in high GUS activity in seedlings, seeds, and nodules.
- The potential of RPS28 and EIF1 promoters to facilitate future genetic engineering and breeding to improve the quality and yield of soybean, as well as in a wide variety of other plant species.
Function-related keywords:
- seedlings , growth , development , plant-development , down-regulated-genes , quality , yield , breeding , plant-growth , flowering-time , flowering , nodules
Literature:
- Characterization of two constitutive promoters RPS28 and EIF1 for studying soybean growth, development, and symbiotic nodule development. DOI: 10.1007/s42994-022-00073-6 ; PMID: 36312443
Related News:
Gene Resources:
Sequences:
cDNA Sequence
- >Glyma.19G203300.1
ATGGAGTCTCAGGTGAAGCACGCACTTGTTGTCAAAGTTATGGGTCGTACTGGATCCAGAGGACAAGTGACCCAGGTTAGAGTGAAGTTTTTGGATGATCAGAACCGTCACATCATGAGGAATGTGAAAGGACCTGTGAGAGAAGGAGACATTCTCACCCTACTCGAGTCTGAAAGGGAAGCAAGAAGATTGCGCTAG
CDS Sequence
- >Glyma.19G203300.1
ATGGAGTCTCAGGTGAAGCACGCACTTGTTGTCAAAGTTATGGGTCGTACTGGATCCAGAGGACAAGTGACCCAGGTTAGAGTGAAGTTTTTGGATGATCAGAACCGTCACATCATGAGGAATGTGAAAGGACCTGTGAGAGAAGGAGACATTCTCACCCTACTCGAGTCTGAAAGGGAAGCAAGAAGATTGCGCTAG
Protein Sequence
- >Glyma.19G203300.1
MESQVKHALVVKVMGRTGSRGQVTQVRVKFLDDQNRHIMRNVKGPVREGDILTLLESEREARRLR*