Gene Details:
- Gene ID: AT5G44130
- Gene Symbol: FLA13
- Gene Name: FASCICLIN-like arabinogalactan protein 13 precursor
- Description: FASCICLIN-like arabinogalactan protein 13 precursor;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
Literature:
- Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis. DOI: 10.1104/pp.010884 ; PMID: 12068095
- Using genomic resources to guide research directions. The arabinogalactan protein gene family as a test case. DOI: 10.1104/pp.003459 ; PMID: 12177459
- Toxicity of free proline revealed in an arabidopsis T-DNA-tagged mutant deficient in proline dehydrogenase. DOI: 10.1093/pcp/pcg066 ; PMID: 12773641
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- Monitoring expression profiles of Arabidopsis gene expression during rehydration process after dehydration using ca 7000 full-length cDNA microarray. DOI: 10.1046/j.1365-313x.2003.01774.x ; PMID: 12795706
- The fasciclin-like arabinogalactan proteins of Arabidopsis. A multigene family of putative cell adhesion molecules. DOI: 10.1104/pp.103.031237 ; PMID: 14645732
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- The potassium-dependent transcriptome of Arabidopsis reveals a prominent role of jasmonic acid in nutrient signaling. DOI: 10.1104/pp.104.046482 ; PMID: 15347784
- CINNAMYL ALCOHOL DEHYDROGENASE-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. DOI: 10.1105/tpc.105.030767 ; PMID: 15937231
- Transcriptome analysis reveals specific modulation of abscisic acid signaling by ROP10 small GTPase in Arabidopsis. DOI: 10.1104/pp.105.068064 ; PMID: 16258012
- AtFLA11, a fasciclin-like arabinogalactan-protein, specifically localized in sclerenchyma cells. DOI: 10.1271/bbb.69.1963 ; PMID: 16244449
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Biosynthesis of cellulose-enriched tension wood in Populus: global analysis of transcripts and metabolites identifies biochemical and developmental regulators in secondary wall biosynthesis. DOI: 10.1111/j.1365-313X.2005.02584.x ; PMID: 16367961
- Systemic signalling of environmental cues in Arabidopsis leaves. DOI: 10.1093/jxb/erj033 ; PMID: 16330523
- A quantitative analysis of Arabidopsis plasma membrane using trypsin-catalyzed (18)O labeling. DOI: 10.1074/mcp.M500414-MCP200 ; PMID: 16635983
- The association among gene expression responses to nine abiotic stress treatments in Arabidopsis thaliana. DOI: 10.1534/genetics.106.061374 ; PMID: 17028338
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptional profiling of mature Arabidopsis trichomes reveals that NOECK encodes the MIXTA-like transcriptional regulator MYB106. DOI: 10.1104/pp.108.126979 ; PMID: 18805951
- Fasciclin-like arabinogalactan proteins: specialization for stem biomechanics and cell wall architecture in Arabidopsis and Eucalyptus. DOI: 10.1111/j.1365-313X.2010.04181.x ; PMID: 20202165
- In silico and expression analyses of fasciclin-like arabinogalactan proteins reveal functional conservation during embryo and seed development. DOI: 10.1007/s00497-019-00376-7 ; PMID: 31501923
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- Large-scale analysis of in vivo phosphorylated membrane proteins by immobilized metal ion affinity chromatography and mass spectrometry. DOI: 10.1074/mcp.T300006-MCP200 ; PMID: 14506206
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- A sub-proteome of Arabidopsis thaliana mature stems trapped on Concanavalin A is enriched in cell wall glycoside hydrolases. DOI: 10.1093/jxb/erm082 ; PMID: 17526915
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- Gene trap lines identify Arabidopsis genes expressed in stomatal guard cells. DOI: 10.1111/j.1365-313X.2007.03371.x ; PMID: 18036199
- Proteomic analysis of glycosylphosphatidylinositol-anchored membrane proteins. DOI: 10.1074/mcp.M300079-MCP200 ; PMID: 14517339
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequences:
cDNA Sequence
- >AT5G44130.1
AACTCATTACGATATTATGCACCTAAGTTTCAAAATAACTTGTTAGGATCATACTGCACAAACGAATTATATGTAAAACTGTATAGAGAATCCAACTTTGTCGGCAAATATTTTGTCAAAATGACTTATTAGCCAATCACATCTCATTCCAACTAAGCCACACCTCATCACTTCAAACATTTTTCTCATCCATATAAATCATTTACCTCTCAACCTCACTTTTCCACTATACTCAAAACACATAAACTCATCTTCAAAACTCAATGGCCACCACTCCTCTCCTCCTCCTTCTCCTCACCGCCGTCTTCCTCTCCACGGAGATAACCGCTCAACGCGCTGCTCCGGCTCCTGGCCCGGCTGGTCCCATCAACATCACGGCAATCCTCGAAAAAGGCGGACAATTTGTTACTCTTATCCGTCTTTTAAACACAACTCAAATAGGAAACCAGATAAACATCCAAATCAACAGTTCATCAGAAGGCATGACCGTGTTAGCACCAACAGACAACGCTTTCCAAAACCTTAAACCCGGAACCCTAAACAAACTAAGCCCGGACGACCAAGTCAAACTCATTCTTTACCATGTCAGTCCCAAATTCTACACATTGGAAGATCTTCTCTCTGTAAGTAACCCGGTCAGAACTCAGGCTTCAGGTCGAGACGTTGGTGGGGTTTACGGACTTAACTTCACCGGTCAAGGGAATCAAGTCAATGTATCTACTGGTGTCGTTGAGACACGTCTCAGTACTTCATTGAGACAAGAACGTCCTCTTGCGGTTTACGTGGTGGACATGGTATTGTTGCCGGAAGAGATGTTTGGAGAACGTAAGATCTCACCGATGGCGCCTCCACCAAAATCAAAATCTCCTGATGTCTCAGATGATTCAGAGTCCTCTAAGAAAGCGGCTGCTCCGTCAGAGTCAGAGAAGTCTGGCTCCGGTGAGATGAATACTGGATTAGGGCTTGGTCTTGGACTTGTTGTGTTGTGTTTGAAATTCCTCCTTTGAGTTTGTTTATATATATTGATTTAATTGTGCGGGTTGTAATAAGAAATTTCTATATGTTTATTATGATGCATGATTTGAAAACTGAAATAAGAGATTATTATTTCGTGTGCATATATATGTATTTTCTGAAATATATACCATGTTCTGAAGATATTTGTATTATTATTAGTTCTTTCGATCTGAAAAATTGACAGCCTCATACGATTGCAATATACAAG
CDS Sequence
Protein Sequence