Gene Details:
- Gene ID: AT5G43170
- Gene Symbol: AZF3, ZF3
- Gene Name: zinc-finger protein 3, zinc-finger protein 3
- Description: zinc-finger protein 3;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Function-related keywords:
- root , root , plant sperm cell
Literature:
- Expression of a subset of the Arabidopsis Cys(2)/His(2)-type zinc-finger protein gene family under water stress. DOI: 10.1016/s0378-1119(00)00133-5 ; PMID: 10806347
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome. DOI: 10.1186/1471-2164-5-39 ; PMID: 15236668
- Identification of 118 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to chitin, a plant-defense elicitor. DOI: 10.1094/MPMI-20-8-0900 ; PMID: 17722694
- Targets of the WRKY53 transcription factor and its role during leaf senescence in Arabidopsis. DOI: 10.1007/s11103-004-2142-6 ; PMID: 15604721
- Systemic and intracellular responses to photooxidative stress in Arabidopsis. DOI: 10.1105/tpc.106.045898 ; PMID: 18156220
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- Establishment of Expression in the SHORTROOT-SCARECROW Transcriptional Cascade through Opposing Activities of Both Activators and Repressors. DOI: 10.1016/j.devcel.2016.09.031 ; PMID: 27923776
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- Systematic identification of genes associated with plant growth-defense tradeoffs under JA signaling in Arabidopsis. DOI: 10.1007/s00425-019-03335-8 ; PMID: 31907627
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Identification of 118 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to chitin, a plant-defense elicitor. DOI: 10.1094/MPMI-20-8-0900 ; PMID: 17722694
Sequences:
cDNA Sequence
- >AT5G43170.1
AAATTTTCTATAGCAATGGCGCTTGAAGCTCTTAATTCACCAAGATTGGTCGAGGATCCCTTAAGATTCAATGGCGTTGAGCAGTGGACCAAATGTAAGAAACGATCCAAACGTTCGAGATCTGATCTTCATCATAACCACCGTCTCACTGAGGAAGAGTATCTAGCTTTCTGTCTCATGCTTCTTGCTCGGGATGGCGGCGATCTTGACTCTGTGACGGTTGCGGAGAAGCCGAGTTATAAGTGTGGCGTTTGTTACAAGACGTTTTCGTCTTACCAAGCTCTCGGCGGTCATAAAGCGAGCCACCGGAGCTTATACGGTGGTGGAGAGAATGATAAATCGACACCATCCACCGCCGTGAAATCTCACGTTTGTTCGGTTTGCGGGAAATCTTTCGCCACCGGTCAAGCTCTCGGCGGCCACAAGCGGTGCCACTACGATGGTGGCGTTTCGAACTCGGAAGGTGTGGGGTCTACTAGCCACGTCAGCAGTAGTAGCCACCGTGGATTTGACCTTAATATTATACCGGTGCAGGGATTTTCGCCGGACGACGAAGTGATGAGTCCGATGGCGACTAAGAAGCCTCGCCTGAAGTAAGTCTTTGTTGAAGACCTGGAAGTTTATCAAATGTAAATATCAAATTTCAATTTCAAGGAACAGTTTTGTTGATTCTATTACCAATACACAATACGATTCAATTCC
CDS Sequence
Protein Sequence