Gene Details:
- Gene ID: AT5G42980
- Gene Symbol: ATH3, ATTRX3, ATTRXH3, TRX3, TRXH3
- Gene Name: thioredoxin H-type 3, thioredoxin 3, thioredoxin 3, THIOREDOXIN H3
- Description: thioredoxin 3;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Function-related keywords:
Literature:
- Evidence for five divergent thioredoxin h sequences in Arabidopsis thaliana. DOI: 10.1073/pnas.92.12.5620 ; PMID: 7777559
- Classification of genes differentially expressed during water-deficit stress in Arabidopsis thaliana: an analysis using microarray and differential expression data. DOI: 10.1093/aob/mcf104 ; PMID: 12102506
- a high-density colony array study (HDCA). DOI: 10.1046/j.1365-313x.2003.01847.x ; PMID: 12969430
- Proteomics of loosely bound cell wall proteins of Arabidopsis thaliana cell suspension cultures: a critical analysis. DOI: 10.1002/elps.200305608 ; PMID: 14595688
- Microarray expression analyses of Arabidopsis guard cells and isolation of a recessive abscisic acid hypersensitive protein phosphatase 2C mutant. DOI: 10.1105/tpc.019000 ; PMID: 14973164
- Gene expression signatures from three genetically separable resistance gene signaling pathways for downy mildew resistance. DOI: 10.1104/pp.104.040444 ; PMID: 15181204
- The hydrophobic proteome of mitochondrial membranes from Arabidopsis cell suspensions. DOI: 10.1016/j.phytochem.2004.03.028 ; PMID: 15276431
- Transcriptional profiling by cDNA-AFLP and microarray analysis reveals novel insights into the early response to ethylene in Arabidopsis. DOI: 10.1111/j.1365-313X.2004.02156.x ; PMID: 15272873
- Molecular phenotyping of the pal1 and pal2 mutants of Arabidopsis thaliana reveals far-reaching consequences on phenylpropanoid, amino acid, and carbohydrate metabolism. DOI: 10.1105/tpc.104.023705 ; PMID: 15377757
- The plant thioredoxin system. DOI: 10.1007/s00018-004-4296-4 ; PMID: 15619004
- Cell wall proteins in apoplastic fluids of Arabidopsis thaliana rosettes: identification by mass spectrometry and bioinformatics. DOI: 10.1002/pmic.200400882 ; PMID: 15593128
- Low-level radiocaesium exposure alters gene expression in roots of Arabidopsis. DOI: 10.1111/j.1469-8137.2005.01485.x ; PMID: 16159328
- Dynamics of Arabidopsis thaliana soluble proteome in response to different nutrient culture conditions. DOI: 10.1002/elps.200500561 ; PMID: 16358359
- Evolution of redoxin genes in the green lineage. DOI: 10.1007/s11120-006-9095-3 ; PMID: 17031546
- Recent advances in plant cell wall proteomics. DOI: 10.1002/pmic.200700938 ; PMID: 18210371
- A novel type of thioredoxin dedicated to symbiosis in legumes. DOI: 10.1104/pp.108.123778 ; PMID: 18614707
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Identification of lipids and lipid-binding proteins in phloem exudates from Arabidopsis thaliana. DOI: 10.1093/jxb/ers028 ; PMID: 22442409
- Analysis of Arabidopsis thioredoxin-h isotypes identifies discrete domains that confer specific structural and functional properties. DOI: 10.1042/BJ20130618 ; PMID: 24003859
- In planta assessment of the role of thioredoxin h proteins in the regulation of S-locus receptor kinase signaling in transgenic Arabidopsis. DOI: 10.1104/pp.113.225672 ; PMID: 24077073
- Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying and up-regulation. DOI: 10.1093/jxb/ert227 ; PMID: 24064926
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Comparative Proteomics Analysis of Phloem Exudates Collected during the Induction of Systemic Acquired Resistance. DOI: 10.1104/pp.16.00269 ; PMID: 27208255
- NPR1 mediates a novel regulatory pathway in cold acclimation by interacting with HSFA1 factors. DOI: 10.1038/s41477-018-0254-2 ; PMID: 30250280
- Capturing the phosphorylation and protein interaction landscape of the plant TOR kinase. DOI: 10.1038/s41477-019-0378-z ; PMID: 30833711
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- The hydrophobic proteome of mitochondrial membranes from Arabidopsis cell suspensions. DOI: 10.1016/j.phytochem.2004.03.028 ; PMID: 15276431
- The plant thioredoxin system. DOI: 10.1007/s00018-004-4296-4 ; PMID: 15619004
- Cell wall proteins in apoplastic fluids of Arabidopsis thaliana rosettes: identification by mass spectrometry and bioinformatics. DOI: 10.1002/pmic.200400882 ; PMID: 15593128
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequences:
cDNA Sequence
- >AT5G42980.1
AACATGTTTTATTAATTATTATTATTATTCCATTTGCATTAAAATATAATAAAAAGATGTAAGATTCTCTCCGCCTCCTTCTCTCTATAAGAACCGACACAGAGACGAAGAAGAATAATCACTCGAAAACTCATCAAATCAAAAATCAAACACAGAGAAGAGAAAATGGCCGCAGAAGGAGAAGTTATCGCTTGCCACACCGTTGAAGATTGGACCGAGAAGCTCAAAGCCGCCAACGAATCCAAGAAACTGATTGTGATAGACTTCACTGCAACATGGTGCCCACCTTGCCGTTTCATTGCACCCGTCTTTGCTGACTTAGCCAAGAAGCACCTCGACGTAGTCTTCTTCAAGGTCGATGTTGACGAATTGAACACTGTTGCTGAGGAGTTTAAAGTTCAGGCAATGCCAACGTTTATCTTCATGAAAGAAGGAGAGATCAAGGAGACTGTGGTTGGTGCTGCTAAAGAAGAAATCATTGCCAATCTCGAGAAGCACAAGACAGTTGTTGCTGCTGCTTGATTTGCTTTTCTCTCTTACCTATTTTGCTAAAATATGTTTGGTGTTTTAATAAATCCTTTGTTCGCCCGAGTCTTTTCACCTTAAATGTGCTCTTATGTGTGGTGGTGAATAAATGTTGTTGCAAACTTGATTACTCGCAGCTATGCTAATTGTTCGTTCATGGTTATGTTTACTCTTTGGGGATTCTATTGTTATGTTAGTTTTTCAATTTTCAATTACATTACACCAACTAGTTATCAATCCAATTACATTGCCAAATACAATTTCGTTTTGCCTAAACTCTCCATGGTTTTTCACTTCAGAAAGGACAAAAGCACAAGGTGTTAATTCAGACACTGAAACATTTCAGATGTCATTTATACATAATGATCCGTTACAGAAAAAAAAGTGGGAGGCCATGAGGAATTTCAATTAGTATTATCAGTCTTGGGAAATTATATAAACCTCTTTTGTAACTGAAAGGAGAGACATCTTACGGTCGTCATCATTAAACCTTGTCGTCATGGAACCACC
CDS Sequence
Protein Sequence