Information report for AT5G42380
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000025 — root tip — punta de la raíz (Spanish, exact), 根端 (Japanese, exact)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
Literature and News
- Analysis of EF-hand-containing proteins in Arabidopsis. DOI: 10.1186/gb-2002-3-10-research0056 ; PMID: 12372144
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- A two-step strategy for detecting differential gene expression in cDNA microarray data. DOI: 10.1007/s00294-004-0551-3 ; PMID: 15688252
- and darkness-regulated Arabidopsis genes: a focus on calmodulin-like and XTH genes. DOI: 10.1111/j.1469-8137.2004.01238.x ; PMID: 15720654
- Handling calcium signaling: Arabidopsis CaMs and CMLs. DOI: 10.1016/j.tplants.2005.07.001 ; PMID: 16023399
- 12-oxo-phytodienoic acid triggers expression of a distinct set of genes and plays a role in wound-induced gene expression in Arabidopsis. DOI: 10.1104/pp.105.067058 ; PMID: 16258017
- Ascorbic acid deficiency activates cell death and disease resistance responses in Arabidopsis. DOI: 10.1104/pp.105.067686 ; PMID: 16244149
- Enhanced tolerance to environmental stress in transgenic plants expressing the transcriptional coactivator multiprotein bridging factor 1c. DOI: 10.1104/pp.105.070110 ; PMID: 16244138
- Gene expression programs during shoot, root, and callus development in Arabidopsis tissue culture. DOI: 10.1104/pp.106.081240 ; PMID: 16648215
- Rapid transcriptome changes induced by cytosolic Ca2+ transients reveal ABRE-related sequences as Ca2+-responsive cis elements in Arabidopsis. DOI: 10.1105/tpc.106.042713 ; PMID: 16980540
- Developmental and stimulus-induced expression patterns of Arabidopsis calmodulin-like genes CML37, CML38 and CML39. DOI: 10.1007/s11103-007-9189-0 ; PMID: 17579812
- Combining classifiers to predict gene function in Arabidopsis thaliana using large-scale gene expression measurements. DOI: 10.1186/1471-2105-8-358 ; PMID: 17888165
- Transcriptional changes in response to growth of Arabidopsis in high external calcium. DOI: 10.1016/j.febslet.2008.02.043 ; PMID: 18307990
- The Arabidopsis SDG4 contributes to the regulation of pollen tube growth by methylation of histone H3 lysines 4 and 36 in mature pollen. DOI: 10.1016/j.ydbio.2007.12.016 ; PMID: 18252252
- Nitric oxide modulates ozone-induced cell death, hormone biosynthesis and gene expression in Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2008.03756.x ; PMID: 19054359
- A subcellular localization compendium of hydrogen peroxide-induced proteins. DOI: 10.1111/j.1365-3040.2011.02323.x ; PMID: 21443605
- Mutation of the Arabidopsis calmodulin-like protein CML37 deregulates the jasmonate pathway and enhances susceptibility to herbivory. DOI: 10.1093/mp/ssu102 ; PMID: 25267731
- Exogenous isoprene modulates gene expression in unstressed Arabidopsis thaliana plants. DOI: 10.1111/pce.12660 ; PMID: 26477606
- Integrative Analysis from the Epigenome to Translatome Uncovers Patterns of Dominant Nuclear Regulation during Transient Stress. DOI: 10.1105/tpc.19.00463 ; PMID: 31519798
- Ethylene Response Factor109 Attunes Immunity, Photosynthesis, and Iron Homeostasis in Arabidopsis Leaves. DOI: 10.3389/fpls.2022.841366 ; PMID: 35310669
- New insights on the regulatory network of drought-responsive key genes in Arabidopsis thaliana. DOI: 10.1007/s10709-022-00177-3 ; PMID: 36474134
- Handling calcium signaling: Arabidopsis CaMs and CMLs. DOI: 10.1016/j.tplants.2005.07.001 ; PMID: 16023399
- Developmental and stimulus-induced expression patterns of Arabidopsis calmodulin-like genes CML37, CML38 and CML39. DOI: 10.1007/s11103-007-9189-0 ; PMID: 17579812
Gene Resources
- UniProt: A0A654G7T0
- EMBL: CACRSJ010000110
- AlphaFoldDB: A0A654G7T0
- EnsemblPlants: AT5G42380.1
- Gramene: AT5G42380.1
- KEGG: ath:AT5G42380
- Orthologous matrix: FNEFTIM
- ExpressionAtlas: AT5G42380
- InterPro: IPR002048, IPR011992, IPR018247
- PANTHER: PTHR23050
- SUPFAM: SSF47473
- PROSITE: PS00018, PS50222
- Gene3D: 1.10.238.10
- SWISS-MODEL: A0A654G7T0
- Conserved Domain Database: cd00051
Sequences
cDNA Sequence
- >AT5G42380.1
TTTTAATTCAAGTTTCTAGGAACAGAGGAAGTCATACCACTTTCGTGGAGCATATCTGGACGGTTATATGAAACTTCATGACAGTTTAACAATTTAAAAGACCAAAACCACGTGTCCGCACATCGTATACTCAATCAAAGTCAAAGAGAAGGTTTGCTACTTTTCTTAATCTAGTCGTCGATATGACATCACATTTCACACAATACGTGAGAAAAACTTACCATCACATTATTACGAAAACACCCCTAGTCGTGGTCAACTTGACCTTTCCCCACAAACACTCATTGCGGAGGAAACTTCCCGGCCACCGCCGCGCAACCGCCTCTAGCTTTAAATAATAACACCAAAATATTCAAACCCGTGTTTTAACCGTCGAACAATCAAGAATCTCTCCACCATTACACGCATTCACATACTCATCTATATATAATCTACCACTTCTTGAAAAGAATTTGCATCAGAAATCCATTTCCCAAATCTTCTAGATTCATATTCAAATCAAGAAATGACTCTCGCTAAGAACCAAAAATCATCATTGTCACGACTATACAAGAAAGTTTCCTCGAAGAGATCAGAATCGTCAAGAAACCTTGAAGACGAATCAAGAACGAGCAGTAATAGTAGCGGAAGCAGCTCGTTAAACGTTAACGAGCTAAGAACCGTTTTTGACTATATGGATGCAAACTCAGACGGGAAAATCTCCGGTGAAGAGCTACAAAGCTGCGTTAGTCTCTTAGGCGGCGCGTTATCGTCACGTGAGGTGGAGGAAGTGGTGAAGACATCAGACGTTGACGGAGACGGGTTTATAGATTTTGAGGAGTTTTTGAAGCTTATGGAAGGGGAAGATGGTAGTGATGAAGAAAGGAGGAAGGAGTTGAAAGAAGCGTTTGGGATGTATGTTATGGAGGGGGAAGAGTTTATTACGGCGGCGAGTTTACGGAGGACGTTGAGTCGACTCGGCGAGTCGTGTACGGTTGATGCTTGTAAGGTTATGATTCGTGGGTTTGATCAGAATGACGATGGAGTTCTCAGCTTTGACGAGTTTGTTTTGATGATGCGTTGAGATGATATATATGGGATTGGGACATCTTCCTTCCCTCCTCAAAATTTTATTCATTCAATTATTATTTTTGTGAGAGATTCTTATTCCTTTGTATATTTGTGTCTCATCTAATCTATTTGTATTATTTAACACACTTCATAATAAACGTGTCTTGTTTTGATATTCTGAATTTGTCAAAACATACAAAATGTGTTTATATGTCTCCCCATAACTGAGAATACCCAATTAAGGGGACTAAAATCTAAAACTGCGAGTCGTAAAAGAGGCCAGTCATCACCACCATTTGCCGCTCGACCAATGTCACTAGGTGA
CDS Sequence
Protein Sequence