Information report for AT5G40370
Gene Details
|
|
Functional Descriptions
- PO:0000282 — trichome — tricoma (Spanish, exact), 毛茸、糸状体、毛 (Japanese, exact), seta (related), setae (related), capilli (narrow), capillus (narrow), cilia (narrow), cilium (narrow), glochid (narrow), glochidia (narrow), glochidium (narrow), hair (narrow), lepides (narrow), lepis (narrow), non-secretory trichome (narrow), scale (narrow), squama (narrow), squamae (narrow), squamella (narrow), squamellae (narrow), squamule (narrow), barb trichome (broad), bristle (broad)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Functional Keywords
- trichome , root , pollen , plant sperm cell , guard cell
Literature and News
- Characterization of a radish introgression carrying the Ogura fertility restorer gene Rfo in rapeseed, using the Arabidopsis genome sequence and radish genetic mapping. DOI: 10.1007/s00122-003-1381-2 ; PMID: 12942173
- Cell-specific protein profiling in Arabidopsis thaliana trichomes: identification of trichome-located proteins involved in sulfur metabolism and detoxification. DOI: 10.1016/j.phytochem.2004.03.026 ; PMID: 15276459
- Genome-wide analysis of plant glutaredoxin systems. DOI: 10.1093/jxb/erl001 ; PMID: 16720602
- Evolution of redoxin genes in the green lineage. DOI: 10.1007/s11120-006-9095-3 ; PMID: 17031546
- Arabidopsis transcriptome changes in response to phloem-feeding silverleaf whitefly nymphs. Similarities and distinctions in responses to aphids. DOI: 10.1104/pp.106.090662 ; PMID: 17189325
- SA-inducible Arabidopsis glutaredoxin interacts with TGA factors and suppresses JA-responsive PDF1.2 transcription. DOI: 10.1111/j.1365-313X.2007.03039.x ; PMID: 17397508
- Inactivation of thioredoxin reductases reveals a complex interplay between thioredoxin and glutathione pathways in Arabidopsis development. DOI: 10.1105/tpc.107.050849 ; PMID: 17586656
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Proteomic analyses of apoplastic proteins from germinating Arabidopsis thaliana pollen. DOI: 10.1016/j.bbapap.2011.07.013 ; PMID: 21798377
- Repression of the Arabidopsis thaliana jasmonic acid/ethylene-induced defense pathway by TGA-interacting glutaredoxins depends on their C-terminal ALWL motif. DOI: 10.1093/mp/ssr113 ; PMID: 22207719
- Cell-specific protein profiling in Arabidopsis thaliana trichomes: identification of trichome-located proteins involved in sulfur metabolism and detoxification. DOI: 10.1016/j.phytochem.2004.03.026 ; PMID: 15276459
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- A reference map of the Arabidopsis thaliana mature pollen proteome. DOI: 10.1016/j.bbrc.2005.09.185 ; PMID: 16242667
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
Gene Resources
- UniProt: B3H604
- EMBL: CP002688
- AlphaFoldDB: B3H604
- EnsemblPlants: AT5G40370.2
- Gramene: AT5G40370.2
- ExpressionAtlas: AT5G40370
- InterPro: IPR002109, IPR011899, IPR014025
- PANTHER: PTHR45694, PTHR45694:SF14
- SUPFAM: SSF52833
- PROSITE: PS51354
- Gene3D: 3.40.30.10
- OrthoDB: B3H604
- SWISS-MODEL: B3H604
- Conserved Domain Database: cd03419
Sequences
cDNA Sequence
- >AT5G40370.2
GACTCGGTTTACAAATATCATCCATTTAGCGTTTTTATAAAGCCGACTGATTCGCTTCTCTTACTACTTCAATTTCATTTCTTTCTCCTCAAAATATCAGATCGATAACCAACAAGCGAAACTAGGGTTCTCTAATCTCGACGAAGATGGCGATGCAGAAAGCTAAGGAGATCGTTAACAGCGAATCAGTCGTTGTTTTCAGGTTCCTCTCTTCTCTCTATTCGCACAAAATTTCCCGCGATTCTCTCGATTACTGTTTGTTTGTGAATCTTCGAATCTGTGTTTTTGGCTTCTTTATATGGATTCGATTATGTGTGTTTCATCATGGAAATTTTATACGATGAACGATTCATGGATGTATCTAGACGCTTTTGTGTACCAATGGATGATTTTGAGTTATTTAATTGGTAATTTTTCTGGAATTTGCAGCAAGACTTATTGTCCATATTGCGTGAGAGTGAAGGAGCTTTTGCAACAATTGGGAGCTAAGTTCAAGGCCGTTGAGCTCGACACCGAAAGTGATGGTAGCCAAATTCAATCAGGTCTCGCAGAATGGACAGGACAACGTACCGTGCCTAATGTGTTTATAGGAGGAAATCACATCGGTGGCTGTGATGCAACATCAAACTTGCATAAAGATGGGAAGTTGGTTCCGCTGTTAACTGAAGCTGGAGCGATCGCAGGAAAGACTGCAACAACTTCTGCTTAAGAGCACATCCATATGTGATTGCTTCTATCAAGAATAAAGAGGTTTGAGTCATAAATGTGAACTTGTTTCGTTGTCAAGTTGAAGAAATATTCTGTAATGTTTTTAAGATTATGGTTATGTCGAAGTCGGATTTGAACTTCTGATACATGATGTTATTATCTTCTGGCTATGCTTTTGGTAACATTTTGGGGTAAATAGAAGAAACTCGAGTCTTAGGCTCTCAGGCAAAATC - >AT5G40370.1
GACTCGGTTTACAAATATCATCCATTTAGCGTTTTTATAAAGCCGACTGATTCGCTTCTCTTACTACTTCAATTTCATTTCTTTCTCCTCAAAATATCAGATCGATAACCAACAAGCGAAACTAGGGTTCTCTAATCTCGACGAAGATGGCGATGCAGAAAGCTAAGGAGATCGTTAACAGCGAATCAGTCGTTGTTTTCAGGTTCCTCTCTTCTCTCTATTCGCACAAAATTTCCCGCGATTCTCTCGATTACTGTTTGTTTGTGAATCTTCGAATCTGTGTTTTTGGCTTCTTTATATGGATTCGATTATGTGTGTTTCATCATGGAAATTTTATACGATGAACGATTCATGGATGTATCTAGACGCTTTTGTGTACCAATGGATGATTTTGAGTTATTTAATTGGTAATTTTTCTGGAATTTGCAGCAAGACTTATTGTCCATATTGCGTGAGAGTGAAGGAGCTTTTGCAACAATTGGGAGCTAAGTTCAAGGCCGTTGAGCTCGACACCGAAAGTGATGGTAGCCAAATTCAATCAGGTCTCGCAGAATGGACAGGACAACGTACCGTGCCTAATGTGTTTATAGGAGGAAATCACATCGGTGGCTGTGATGCAACATCAAACTTGCATAAAGATGGGAAGTTGGTTCCGCTGTTAACTGAAGCTGGAGCGATCGCAGGAAAGACTGCAACAACTTCTGCTTAAGAGCACATCCATATGTGATTGCTTCTATCAAGAATAAAGAGGTTTGAGTCATAAATGTGAACTTGTTTCGTTGTCAAGTTGAAGAAATATTCTGTAATGTTTTTAAGATTATGGTTATGTCGAAGTCGGATTTGAACTTCTGATACATGATGTTATTATCTTCTGGCTATGCTTTTGGTAACATTTTGGGGTAAATAGAAGAAACTCGAGTCTTAGGCTCTCAGGCAAAATC
CDS Sequence
Protein Sequence