Gene Details:
- Gene ID: AT5G39860
- Gene Symbol: BHLH136, BNQ1, PRE1
- Gene Name: BASIC HELIX-LOOP-HELIX PROTEIN 136, BANQUO 1, PACLOBUTRAZOL RESISTANCE1
- Description: basic helix-loop-helix (bHLH) DNA-binding family protein;(source:Araport11)
- TAIR Accession: locus:2178002
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0005515 — enables — protein binding
- GO:0006355 — involved in — regulation of DNA-templated transcription
- GO:0005634 — located in — nucleus
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0040008 — involved in — regulation of growth
- GO:0009741 — acts upstream of or within — response to brassinosteroid
- GO:0009640 — acts upstream of or within — photomorphogenesis
- GO:0048510 — acts upstream of or within — regulation of timing of transition from vegetative to reproductive phase
- GO:0009826 — acts upstream of or within — unidimensional cell growth
- GO:0046983 — enables — protein dimerization activity
Function-related keywords:
Literature:
- The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. DOI: 10.1093/molbev/msg088 ; PMID: 12679534
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Update on the basic helix-loop-helix transcription factor gene family in Arabidopsis thaliana. DOI: 10.1105/tpc.151140 ; PMID: 14600211
- A global survey of gene regulation during cold acclimation in Arabidopsis thaliana. DOI: 10.1371/journal.pgen.0010026 ; PMID: 16121258
- Overexpression of PRE1 and its homologous genes activates Gibberellin-dependent responses in Arabidopsis thaliana. DOI: 10.1093/pcp/pcj026 ; PMID: 16527868
- KIDARI, encoding a non-DNA Binding bHLH protein, represses light signal transduction in Arabidopsis thaliana. DOI: 10.1007/s11103-006-0010-2 ; PMID: 16786307
- Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seed germination and floral development in Arabidopsis. DOI: 10.1104/pp.106.082289 ; PMID: 16920880
- Genome-wide gene expression analysis reveals a critical role for CRYPTOCHROME1 in the response of Arabidopsis to high irradiance. DOI: 10.1104/pp.107.098293 ; PMID: 17478635
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Regulation of Arabidopsis brassinosteroid signaling by atypical basic helix-loop-helix proteins. DOI: 10.1105/tpc.109.072504 ; PMID: 20023194
- Antagonistic HLH/bHLH transcription factors mediate brassinosteroid regulation of cell elongation and plant development in rice and Arabidopsis. DOI: 10.1105/tpc.109.070441 ; PMID: 20009022
- The Arabidopsis floral homeotic proteins APETALA3 and PISTILLATA negatively regulate the BANQUO genes implicated in light signaling. DOI: 10.1105/tpc.109.065946 ; PMID: 20305124
- The non-DNA-binding bHLH transcription factor PRE3/bHLH135/ATBS1/TMO7 is involved in the regulation of light signaling pathway in Arabidopsis. DOI: 10.1111/j.1399-3054.2012.01600.x ; PMID: 22339648
- A survey of dominant mutations in Arabidopsis thaliana. DOI: 10.1016/j.tplants.2012.08.006 ; PMID: 22995285
- A triantagonistic basic helix-loop-helix system regulates cell elongation in Arabidopsis. DOI: 10.1105/tpc.112.105023 ; PMID: 23161888
- A triple helix-loop-helix/basic helix-loop-helix cascade controls cell elongation downstream of multiple hormonal and environmental signaling pathways in Arabidopsis. DOI: 10.1105/tpc.112.105163 ; PMID: 23221598
- ATBS1 INTERACTING FACTORs negatively regulate Arabidopsis cell elongation in the triantagonistic bHLH system. DOI: 10.4161/psb.23448 ; PMID: 23333962
- Interactions between HLH and bHLH factors modulate light-regulated plant development. DOI: 10.1093/mp/sss011 ; PMID: 22331621
- Antagonistic regulation of growth and immunity by the Arabidopsis basic helix-loop-helix transcription factor homolog of brassinosteroid enhanced expression2 interacting with increased leaf inclination1 binding bHLH1. DOI: 10.1104/pp.113.234625 ; PMID: 24443525
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- The G-Box Transcriptional Regulatory Code in Arabidopsis. DOI: 10.1104/pp.17.01086 ; PMID: 28864470
- Linking PHYTOCHROME-INTERACTING FACTOR to Histone Modification in Plant Shade Avoidance. DOI: 10.1104/pp.17.01189 ; PMID: 29187567
- PACLOBUTRAZOL-RESISTANCE Gene Family Regulates Floral Organ Growth with Unequal Genetic Redundancy in Arabidopsis thaliana. DOI: 10.3390/ijms20040869 ; PMID: 30781591
- Class I TCP Transcription Factors Target the Gibberellin Biosynthesis Gene GA20ox1 and the Growth-Promoting Genes HBI1 and PRE6 during Thermomorphogenic Growth in Arabidopsis. DOI: 10.1093/pcp/pcz137 ; PMID: 31292642
- Phospho-Mutant Activity Assays Provide Evidence for the Negative Regulation of Transcriptional Regulator PRE1 by Phosphorylation. DOI: 10.3390/ijms21239183 ; PMID: 33276448
- MiR160 and its target genes ARF10, ARF16 and ARF17 modulate hypocotyl elongation in a light, BRZ, or PAC-dependent manner in Arabidopsis: miR160 promotes hypocotyl elongation. DOI: 10.1016/j.plantsci.2020.110686 ; PMID: 33487334
- Arabidopsis NF-YCs play dual roles in repressing brassinosteroid biosynthesis and signaling during light-regulated hypocotyl elongation. DOI: 10.1093/plcell/koab112 ; PMID: 33871651
- Overexpression of HLH4 Inhibits Cell Elongation and Anthocyanin Biosynthesis in Arabidopsis thaliana. DOI: 10.3390/cells11071087 ; PMID: 35406652
- The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. DOI: 10.1093/molbev/msg088 ; PMID: 12679534
Sequences:
cDNA Sequence
- >AT5G39860.1
GGCCTATTTAAATCTCTCTTATCACATTCTCAATTTCTTTATATTTGAAGTGTATTCAAAACCCCAAAACACTTTTCTCATTCTCTTCTCTATTTTCTTCTTGCTCTCTAGTTTTTCTTTCTTCTTGGTCGTTTCCTTTCAGCATAAAAACCTTATAAAATCATAAAAGCTTACACCTACTTGCCACATAGACATAGCCGATCTCATTATATCTCTATTTCTATTTCTCAATAGAACTTGTTTGAGCTAGTGTGAGAGAAGTAAAGAAAGAGAGAAGAATCCACAACTTAGTTAGGGTCTTTTCTTGCCACATTGTTGAACATGTCGAACAGAAGATCAAGGCAATCTTCAAGTGCTCCAAGGATCTCCGATAATCAAATGATTGACCTCGTATCTAAGCTCCGTCAAATTTTGCCGGAGATTGGTCAACGACGTCGTTCTGATAAGGCATCAGCCTCGAAAGTATTGCAAGAGACATGCAATTACATACGAAATTTGAACAGAGAAGTTGACAATCTGAGCGAGCGTTTGTCTCAGCTTCTCGAATCTGTCGATGAAGATAGCCCTGAAGCCGCCGTTATTAGAAGCCTACTCATGTAATCTTTTTTGTTCTTTTGTTTGTTTTTGACAAGCCTATCCATGTAATCTTAAATGATCGCTCTATAATAATTATATTTTTAACATAATCGTCTTATTATGTAAAATTCAAAGAGATGGGCTTGATCTTTAATGACATACGAATTTCATAGGGTTAATTCCATAGTCAAAAGTCTCCGACATATATGTGTGTAGCAGAACTGCACGAGCATTGCCTTAGCAGGTGCATTATTAAAATAAACCAGTGGGATGAAATTTG
CDS Sequence
Protein Sequence