Information report for AT5G39610
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0000014 — rosette leaf — hoja en roseta (Spanish, exact), ロゼット葉 (Japanese, exact)
- PO:0005052 — plant callus — callo (Spanish, exact), portion of plant callus tissue (exact), 植物カルス (Japanese, exact), callus (broad)
Functional Keywords
- root , root , flower , rosette leaf , plant callus
Literature and News
- Identification of three genetic loci controlling leaf senescence in Arabidopsis thaliana. DOI: 10.1046/j.1365-313x.1997.00527.x ; PMID: 9351240
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DOI: 10.1093/dnares/10.6.239 ; PMID: 15029955
- AtNAC2, a transcription factor downstream of ethylene and auxin signaling pathways, is involved in salt stress response and lateral root development. DOI: 10.1111/j.1365-313X.2005.02575.x ; PMID: 16359384
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Forward and reverse genetics to identify genes involved in the age-related resistance response in Arabidopsis thaliana. DOI: 10.1111/j.1364-3703.2009.00557.x ; PMID: 19694953
- YUCCA6 over-expression demonstrates auxin function in delaying leaf senescence in Arabidopsis thaliana. DOI: 10.1093/jxb/err094 ; PMID: 21511905
- Overexpression of AtCHX24, a member of the cation/H⁺ exchangers, accelerates leaf senescence in Arabidopsis thaliana. DOI: 10.1016/j.plantsci.2011.08.008 ; PMID: 22195591
- Early senescence and cell death in Arabidopsis saul1 mutants involves the PAD4-dependent salicylic acid pathway. DOI: 10.1104/pp.112.196220 ; PMID: 22706448
- A genome-wide transcriptome profiling reveals the early molecular events during callus initiation in Arabidopsis multiple organs. DOI: 10.1016/j.ygeno.2012.05.013 ; PMID: 22664253
- Carbon deprivation-driven transcriptome reprogramming in detached developmentally arresting Arabidopsis inflorescences. DOI: 10.1104/pp.112.203083 ; PMID: 22930749
- γ-Aminobutyric acid transaminase deficiency impairs central carbon metabolism and leads to cell wall defects during salt stress in Arabidopsis roots. DOI: 10.1111/pce.12033 ; PMID: 23148892
- ORE1 balances leaf senescence against maintenance by antagonizing G2-like-mediated transcription. DOI: 10.1038/embor.2013.24 ; PMID: 23459204
- Transcriptional dynamics of two seed compartments with opposing roles in Arabidopsis seed germination. DOI: 10.1104/pp.113.223511 ; PMID: 23858430
- Mutation of the Arabidopsis NAC016 transcription factor delays leaf senescence. DOI: 10.1093/pcp/pct113 ; PMID: 23926065
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- Gene regulatory cascade of senescence-associated NAC transcription factors activated by ETHYLENE-INSENSITIVE2-mediated leaf senescence signalling in Arabidopsis. DOI: 10.1093/jxb/eru112 ; PMID: 24659488
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- Urea retranslocation from senescing Arabidopsis leaves is promoted by DUR3-mediated urea retrieval from leaf apoplast. DOI: 10.1111/tpj.12740 ; PMID: 25440717
- Transcription Factor ATAF1 in Arabidopsis Promotes Senescence by Direct Regulation of Key Chloroplast Maintenance and Senescence Transcriptional Cascades. DOI: 10.1104/pp.15.00567 ; PMID: 25953103
- PHYTOCHROME-INTERACTING FACTOR 5 (PIF5) positively regulates dark-induced senescence and chlorophyll degradation in Arabidopsis. DOI: 10.1016/j.plantsci.2015.05.010 ; PMID: 26089152
- EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in Arabidopsis. DOI: 10.1371/journal.pgen.1005399 ; PMID: 26218222
- Arabidopsis EARLY FLOWERING3 increases salt tolerance by suppressing salt stress response pathways. DOI: 10.1111/tpj.13747 ; PMID: 29032592
- CIRCADIAN CLOCK-ASSOCIATED 1 Inhibits Leaf Senescence in Arabidopsis. DOI: 10.3389/fpls.2018.00280 ; PMID: 29559987
- Circadian control of ORE1 by PRR9 positively regulates leaf senescence in Arabidopsis. DOI: 10.1073/pnas.1722407115 ; PMID: 30065116
- Arabidopsis NITROGEN LIMITATION ADAPTATION regulates ORE1 homeostasis during senescence induced by nitrogen deficiency. DOI: 10.1038/s41477-018-0269-8 ; PMID: 30374089
- Arabidopsis ANAC092 regulates auxin-mediated root development by binding to the ARF8 and PIN4 promoters. DOI: 10.1111/jipb.12735 ; PMID: 30415491
- Senescence and Defense Pathways Contribute to Heterosis. DOI: 10.1104/pp.18.01205 ; PMID: 30710054
- The H3K27me3 demethylase REF6 promotes leaf senescence through directly activating major senescence regulatory and functional genes in Arabidopsis. DOI: 10.1371/journal.pgen.1008068 ; PMID: 30969965
- Arabidopsis ubiquitin-specific proteases UBP12 and UBP13 shape ORE1 levels during leaf senescence induced by nitrogen deficiency. DOI: 10.1111/nph.15879 ; PMID: 31050353
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- PROTEIN PHOSPHATASE 2A-B'γ Controls Botrytis cinerea Resistance and Developmental Leaf Senescence. DOI: 10.1104/pp.19.00893 ; PMID: 31659127
- Calcium-Dependent Protein Kinase CPK1 Controls Cell Death by In Vivo Phosphorylation of Senescence Master Regulator ORE1. DOI: 10.1105/tpc.19.00810 ; PMID: 32111670
- Genetic Interaction Among Phytochrome, Ethylene and Abscisic Acid Signaling During Dark-Induced Senescence in Arabidopsis thaliana. DOI: 10.3389/fpls.2020.00564 ; PMID: 32508856
- High Ambient Temperature Accelerates Leaf Senescence via PHYTOCHROME-INTERACTING FACTOR 4 and 5 in Arabidopsis. DOI: 10.14348/molcells.2020.0117 ; PMID: 32732458
- Gene expression changes occurring at bolting time are associated with leaf senescence in Arabidopsis. DOI: 10.1002/pld3.279 ; PMID: 33204935
- Subcellular Localization of GIGANTEA Regulates the Timing of Leaf Senescence and Flowering in Arabidopsis. DOI: 10.3389/fpls.2020.589707 ; PMID: 33329652
- Ethylene and salicylic acid synergistically accelerate leaf senescence in Arabidopsis. DOI: 10.1111/jipb.13075 ; PMID: 33501715
- BAK1-induced RPK1 phosphorylation is essential for RPK1-mediated cell death in Arabidopsis. DOI: 10.1016/j.bbrc.2021.08.027 ; PMID: 34403809
- Arabidopsis WRKY71 regulates ethylene-mediated leaf senescence by directly activating EIN2, ORE1 and ACS2 genes. DOI: 10.1111/tpj.15433 ; PMID: 34296474
- The Transcriptional Corepressor HOS15 Mediates Dark-Induced Leaf Senescence in Arabidopsis. DOI: 10.3389/fpls.2022.828264 ; PMID: 35283908
- Rapid Investigation of Functional Roles of Genes in Regulation of Leaf Senescence Using Arabidopsis Protoplasts. DOI: 10.3389/fpls.2022.818239 ; PMID: 35371171
- Dynamic Changes in Reactive Oxygen Species in the Shoot Apex Contribute to Stem Cell Death in Arabidopsis thaliana. DOI: 10.3390/ijms23073864 ; PMID: 35409227
- Scaffold protein RACK1A positively regulates leaf senescence by coordinating the EIN3-miR164-ORE1 transcriptional cascade in Arabidopsis. DOI: 10.1111/jipb.13483 ; PMID: 36939002
- A VEL3 histone deacetylase complex establishes a maternal epigenetic state controlling progeny seed dormancy. DOI: 10.1038/s41467-023-37805-1 ; PMID: 37072400
- Fertility loss in senescing Arabidopsis ovules is controlled by the maternal sporophyte via a NAC transcription factor triad. DOI: 10.1073/pnas.2219868120 ; PMID: 37307449
- Identification of three genetic loci controlling leaf senescence in Arabidopsis thaliana. DOI: 10.1046/j.1365-313x.1997.00527.x ; PMID: 9351240
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The CUP-SHAPED COTYLEDON1 gene of Arabidopsis regulates shoot apical meristem formation. DOI: 10.1242/dev.128.7.1127 ; PMID: 11245578
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
Gene Resources
- UniProt: A0A654G6C9
- EMBL: CACRSJ010000110, CACSHJ010000096
- AlphaFoldDB: A0A654G6C9
- EnsemblPlants: AT5G39610.1
- Gramene: AT5G39610.1
- KEGG: ath:AT5G39610
- Orthologous matrix: MLDPHIN
- ExpressionAtlas: AT5G39610
- InterPro: IPR003441, IPR036093
- PANTHER: PTHR31744, PTHR31744:SF201
- SUPFAM: SSF101941
- PROSITE: PS51005
- Gene3D: 2.170.150.80
- OrthoDB: A0A654G6C9
- SWISS-MODEL: A0A654G6C9
Sequences
cDNA Sequence
- >AT5G39610.1
GAAGAACTTGATACGAAAAAATTGACCAATTATTGGTCAATATATTAAAAAGAATAAATTATTTTAGTGTTCTTATTTCTCAAATGAAAACTAGTATATAGAGAGGAGCTTCGTTGCTCAAACACTTTCCTCTCTCTTAAAAACCTCAACTTTCTTCTCTCTTCTCAAAAACCCTTCCCTCTTCGTCTCCAAACAACAACAAACACAACAACAACAAAAATCTTACAAGAAGATCATTTTTAGAAACCCTATTAGGATAAAATGGATTACGAGGCATCAAGAATCGTCGAAATGGTAGAAGATGAAGAACATATAGATCTACCACCAGGATTCAGATTTCACCCTACTGATGAAGAACTCATAACTCACTACCTCAAACCAAAGGTTTTCAACACTTTCTTCTCTGCTACTGCCATTGGTGAAGTTGATCTCAACAAGATTGAGCCTTGGGACTTACCATGGAAGGCTAAGATGGGAGAAAAAGAATGGTATTTCTTCTGTGTGAGAGACCGGAAATACCCGACCGGTTTAAGGACAAACCGGGCGACAGAAGCCGGTTATTGGAAAGCCACAGGAAAAGACAAAGAGATATTCAAGGGAAAATCACTTGTGGGTATGAAGAAAACTTTGGTTTTCTATAAAGGAAGAGCTCCTAAAGGAGTTAAAACCAATTGGGTTATGCATGAATATCGTTTAGAAGGCAAATATTGTATTGAAAATCTTCCCCAAACAGCTAAGAACGAATGGGTTATATGTCGTGTTTTCCAAAAACGTGCCGATGGTACAAAGGTTCCAATGTCAATGCTTGATCCACACATTAACCGAATGGAACCAGCCGGTTTACCTTCGTTAATGGATTGTTCTCAACGAGACTCCTTCACCGGTTCGTCGTCTCACGTGACCTGCTTCTCCGACCAAGAAACCGAAGACAAAAGACTTGTCCACGAGTCCAAAGACGGTTTTGGTTCTCTGTTTTACTCGGATCCTCTGTTTTTACAAGACAATTATTCGCTAATGAAGCTGTTGCTTGACGGTCAAGAAACTCAATTCTCCGGCAAACCTTTCGACGGTCGTGATTCGTCCGGTACAGAAGAATTGGATTGCGTTTGGAATTTCTGAGTTGTATAAGTTATGTTGTAGACTTGTAGTAGTCATGTGTTCGTGTGTGTGAATGAATATTCTTGTTACATTTTTTTGTAAAAAAGGAGAAAAAAATATGCTAGAAAGTCAATTGCTTTTGTTATGTAGCATTAGTGTTTTTTATGTACTCAATAGACTTCCTAATTAAATAAAAATCTTAATTTATTTGCCA
CDS Sequence
Protein Sequence