Information report for AT5G38430
Gene Details
|
|
Functional Descriptions
- PO:0005020 — vascular bundle — haz vascular (Spanish, exact), vein (exact), 維管束 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Functional Keywords
Literature and News
- Genomic evidence for COP1 as a repressor of light-regulated gene expression and development in Arabidopsis. DOI: 10.1105/tpc.004416 ; PMID: 12368493
- Comparative analysis of the Arabidopsis pollen transcriptome. DOI: 10.1104/pp.103.020925 ; PMID: 12805594
- Nuclear genes that encode mitochondrial proteins for DNA and RNA metabolism are clustered in the Arabidopsis genome. DOI: 10.1105/tpc.010009 ; PMID: 12837951
- Expression profiling of cytokinin action in Arabidopsis. DOI: 10.1104/pp.103.021436 ; PMID: 12913156
- The Arabidopsis ppi1 mutant is specifically defective in the expression, chloroplast import, and accumulation of photosynthetic proteins. DOI: 10.1105/tpc.012955 ; PMID: 12897258
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- PathMAPA: a tool for displaying gene expression and performing statistical tests on metabolic pathways at multiple levels for Arabidopsis. DOI: 10.1186/1471-2105-4-56 ; PMID: 14604444
- The Arabidopsis thaliana ABSCISIC ACID-INSENSITIVE8 encodes a novel protein mediating abscisic acid and sugar responses essential for growth. DOI: 10.1105/tpc.018077 ; PMID: 14742875
- Maximizing the efficacy of SAGE analysis identifies novel transcripts in Arabidopsis. DOI: 10.1104/pp.104.043406 ; PMID: 15489285
- Transcriptional similarities, dissimilarities, and conservation of cis-elements in duplicated genes of Arabidopsis. DOI: 10.1104/pp.104.046466 ; PMID: 15489284
- Translational regulation via 5' mRNA leader sequences revealed by mutational analysis of the Arabidopsis translation initiation factor subunit eIF3h. DOI: 10.1105/tpc.104.026880 ; PMID: 15548739
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show and long-term exposure to low temperature. DOI: 10.1111/j.1365-313X.2006.02821.x ; PMID: 16923014
- Comparative proteomic approaches for the isolation of proteins interacting with thioredoxin. DOI: 10.1002/pmic.200600443 ; PMID: 17163439
- The EAR-motif of the Cys2/His2-type zinc finger protein Zat7 plays a key role in the defense response of Arabidopsis to salinity stress. DOI: 10.1074/jbc.M611093200 ; PMID: 17259181
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Integrative analyses of genetic variation in enzyme activities of primary carbohydrate metabolism reveal distinct modes of regulation in Arabidopsis thaliana. DOI: 10.1186/gb-2008-9-8-r129 ; PMID: 18710526
- Unique and overlapping expression patterns among members of photosynthesis-associated nuclear gene families in Arabidopsis. DOI: 10.1104/pp.108.126946 ; PMID: 18820083
- RBCS1A and RBCS3B, two major members within the Arabidopsis RBCS multigene family, function to yield sufficient Rubisco content for leaf photosynthetic capacity. DOI: 10.1093/jxb/err434 ; PMID: 22223809
- Arabidopsis Pol II-Dependent in Vitro Transcription System Reveals Role of Chromatin for Light-Inducible rbcS Gene Transcription. DOI: 10.1104/pp.15.01614 ; PMID: 26662274
- Structure of Rubisco from Arabidopsis thaliana in complex with 2-carboxyarabinitol-1,5-bisphosphate. DOI: 10.1107/S2059798317017132 ; PMID: 29372894
- Molecular Topology of the Transit Peptide during Chloroplast Protein Import. DOI: 10.1105/tpc.18.00172 ; PMID: 29991536
- Multiple Kinases Can Phosphorylate the N-Terminal Sequences of Mitochondrial Proteins in Arabidopsis thaliana. DOI: 10.3389/fpls.2018.00982 ; PMID: 30042778
- Multiple intramolecular trafficking signals in RESISTANCE TO POWDERY MILDEW 8.2 are engaged in activation of cell death and defense. DOI: 10.1111/tpj.14199 ; PMID: 30552775
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Proteomics of the chloroplast envelope membranes from Arabidopsis thaliana. DOI: 10.1074/mcp.M300030-MCP200 ; PMID: 12766230
- Proteomic study of the Arabidopsis thaliana chloroplastic envelope membrane utilizing alternatives to traditional two-dimensional electrophoresis. DOI: 10.1021/pr034025j ; PMID: 12938931
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- High light response of the thylakoid proteome in arabidopsis wild type and the ascorbate-deficient mutant vtc2-2. A comparative proteomics study. DOI: 10.1104/pp.106.080150 ; PMID: 16648217
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. DOI: 10.1016/j.phytochem.2008.04.007 ; PMID: 18538804
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- The oligomeric stromal proteome of Arabidopsis thaliana chloroplasts. DOI: 10.1074/mcp.M500180-MCP200 ; PMID: 16207701
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A5S9YBC0
- EMBL: CACRSJ010000110, CACSHJ010000096
- AlphaFoldDB: A0A5S9YBC0
- EnsemblPlants: AT5G38430.1, AT5G38430.2
- Gramene: AT5G38430.1, AT5G38430.2
- KEGG: ath:AT5G38430
- Orthologous matrix: RKNWVPC
- ExpressionAtlas: AT5G38430
- InterPro: IPR000894, IPR024680, IPR024681
- PANTHER: PTHR31262, PTHR31262:SF10
- SUPFAM: SSF55239
- Gene3D: 3.30.190.10
- OrthoDB: A0A5S9YBC0
- SWISS-MODEL: A0A5S9YBC0
- Conserved Domain Database: cd03527
Sequences
cDNA Sequence
- >AT5G38430.2
ATTAGGCAAAAGAAGAAGAAGAAGAAGTAATGGCTTCCTCTATGCTCTCCTCTGCCGCTGTGGTTACCTCCCCGGCTCAAGCCACCATGGTCGCTCCATTCACTGGTTTGAAGTCATCCGCTTCTTTCCCGGTCACCCGCAAGGCCAACAACGACATTACTTCCATCACAAGCAATGGGGGAAGAGTTAGCTGCATGAAGGTGTGGCCACCAATCGGAAAGAAGAAGTTTGAGACTCTATCTTACCTCCCTGACCTTACTGACGTCGAATTGGCTAAGGAAGTTGACTACCTTCTCCGCAACAAATGGATTCCTTGTGTTGAATTCGAGTTGGAGCACGGATTTGTGTACCGTGAGCACGGAAACACTCCCGGATACTACGATGGACGGTACTGGACAATGTGGAAGCTTCCATTGTTCGGATGCACCGACTCCGCTCAAGTGTTGAAGGAAGTTGAAGAATGCAAGAAGGAGTACCCGGGCGCCTTCATTAGGATCATCGGATTCGACAACACCCGTCAAGTCCAATGCATCAGTTTCATTGCCTACAAGCCCCCAAGCTTCACTGATGCTTAAATCCTTTTCTGGAATATTCAATGTTGACTATCCGGAACCCAATTTTGTATGGTCAATGTAAATTTAAGTAATTATTTTGCCAAAGTGAAAAAACTGAAGGTTTGTTTTTCTATCGTTTCCTCTATAAAAATCTCTATTCATATCACTTCATTTCTGCTCTTATCACTTTTAACTCTTTTTATTCGTTTTATCTCTTTTAACTAACATTTTAGTTCCTTTAAATTTCTCTCCTAATTCTTGCCTTTGGTTCTCTAATGAAAGAGTA - >AT5G38430.1
ATTAGGCAAAAGAAGAAGAAGAAGAAGTAATGGCTTCCTCTATGCTCTCCTCTGCCGCTGTGGTTACCTCCCCGGCTCAAGCCACCATGGTCGCTCCATTCACTGGTTTGAAGTCATCCGCTTCTTTCCCGGTCACCCGCAAGGCCAACAACGACATTACTTCCATCACAAGCAATGGGGGAAGAGTTAGCTGCATGAAGGTGTGGCCACCAATCGGAAAGAAGAAGTTTGAGACTCTATCTTACCTCCCTGACCTTACTGACGTCGAATTGGCTAAGGAAGTTGACTACCTTCTCCGCAACAAATGGATTCCTTGTGTTGAATTCGAGTTGGAGCACGGATTTGTGTACCGTGAGCACGGAAACACTCCCGGATACTACGATGGACGGTACTGGACAATGTGGAAGCTTCCATTGTTCGGATGCACCGACTCCGCTCAAGTGTTGAAGGAAGTTGAAGAATGCAAGAAGGAGTACCCGGGCGCCTTCATTAGGATCATCGGATTCGACAACACCCGTCAAGTCCAATGCATCAGTTTCATTGCCTACAAGCCCCCAAGCTTCACTGATGCTTAAATCCTTTTCTGGAATATTCAATGTTGACTATCCGGAACCCAATTTTGTATGGTCAATGTAAATTTAAGTAATTATTTTGCCAAAGTGAAAAAACTGAAGGTTTGTTTTTCTATCGTTTCCTCTATAAAAATCTCTATTCATATCACTTCATTTCTGCTCTTATCACTTTTAACTCTTTTTATTCGTTTTATCTCTTTTAACTAACATTTTAGTTCCTTTAAATTTCTCTCCTAATTCTTGCCTTTGGTTCTCTAATGAAAGAGTA
CDS Sequence
Protein Sequence