Information report for AT5G37260
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- GO:0007623 — acts upstream of or within — circadian rhythm
- GO:0005515 — enables — protein binding
- GO:0009909 — acts upstream of or within — regulation of flower development
- GO:0006355 — acts upstream of or within — regulation of DNA-templated transcription
- GO:0009845 — acts upstream of or within — seed germination
- GO:0005634 — located in — nucleus
- GO:0003700 — enables — DNA-binding transcription factor activity
Functional Keywords
Literature and News
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Overexpression of spermidine synthase enhances tolerance to multiple environmental stresses and up-regulates the expression of various stress-regulated genes in transgenic Arabidopsis thaliana. DOI: 10.1093/pcp/pch083 ; PMID: 15215506
- Regulation of flowering time in Arabidopsis by K homology domain proteins. DOI: 10.1073/pnas.0404552101 ; PMID: 15310842
- The cold-induced early activation of phospholipase C and D pathways determines the response of two distinct clusters of genes in Arabidopsis cell suspensions. DOI: 10.1104/pp.105.068171 ; PMID: 16258011
- The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. DOI: 10.1007/s11103-005-2910-y ; PMID: 16463103
- Expression profiling and local adaptation of Boechera holboellii populations for water use efficiency across a naturally occurring water stress gradient. DOI: 10.1111/j.1365-294X.2006.02818.x ; PMID: 16626450
- Functional profiling reveals that only a small number of phytochrome-regulated early-response genes in Arabidopsis are necessary for optimal deetiolation. DOI: 10.1105/tpc.106.042200 ; PMID: 16891401
- Co-expression of the stress-inducible zinc finger homeodomain ZFHD1 and NAC transcription factors enhances expression of the ERD1 gene in Arabidopsis. DOI: 10.1111/j.1365-313X.2006.02932.x ; PMID: 17233795
- PIP5K9, an Arabidopsis phosphatidylinositol monophosphate kinase, interacts with a cytosolic invertase to negatively regulate sugar-mediated root growth. DOI: 10.1105/tpc.106.045658 ; PMID: 17220200
- Temporal responses of transcripts, enzyme activities and metabolites after adding sucrose to carbon-deprived Arabidopsis seedlings. DOI: 10.1111/j.1365-313X.2006.02979.x ; PMID: 17217462
- Constitutive expression of CIR1 (RVE2) affects several circadian-regulated processes and seed germination in Arabidopsis. DOI: 10.1111/j.1365-313X.2007.03156.x ; PMID: 17587236
- A putative CCAAT-binding transcription factor is a regulator of flowering timing in Arabidopsis. DOI: 10.1104/pp.107.102079 ; PMID: 17631525
- Light has a specific role in modulating Arabidopsis gene expression at low temperature. DOI: 10.1186/1471-2229-8-13 ; PMID: 18230142
- Global transcript levels respond to small changes of the carbon status during progressive exhaustion of carbohydrates in Arabidopsis rosettes. DOI: 10.1104/pp.107.115592 ; PMID: 18305208
- Knocking out cytosolic cysteine synthesis compromises the antioxidant capacity of the cytosol to maintain discrete concentrations of hydrogen peroxide in Arabidopsis. DOI: 10.1104/pp.108.117408 ; PMID: 18441224
- REVEILLE1, a Myb-like transcription factor, integrates the circadian clock and auxin pathways. DOI: 10.1073/pnas.0813035106 ; PMID: 19805390
- A DEAD box RNA helicase is critical for pre-mRNA splicing, cold-responsive gene regulation, and cold tolerance in Arabidopsis. DOI: 10.1105/tpc.112.108340 ; PMID: 23371945
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- Phytochrome B and REVEILLE1/2-mediated signalling controls seed dormancy and germination in Arabidopsis. DOI: 10.1038/ncomms12377 ; PMID: 27506149
- FHY3 interacts with phytochrome B and regulates seed dormancy and germination. DOI: 10.1093/plphys/kiab147 ; PMID: 33764465
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. DOI: 10.1007/s11103-005-2910-y ; PMID: 16463103
Gene Resources
- UniProt: A0A654G5P5
- EMBL: CACRSJ010000110
- AlphaFoldDB: A0A654G5P5
- EnsemblPlants: AT5G37260.1
- Gramene: AT5G37260.1
- KEGG: ath:AT5G37260
- Orthologous matrix: MAMQERC
- ExpressionAtlas: AT5G37260
- InterPro: IPR001005, IPR006447, IPR009057
- PANTHER: PTHR12802, PTHR12802:SF175
- SUPFAM: SSF46689
- PROSITE: PS50090, PS51293, PS51294
- Gene3D: 1.10.10.60
- SWISS-MODEL: A0A654G5P5
- Conserved Domain Database: cd00167
Sequences
cDNA Sequence
- >AT5G37260.1
ATAAACAACAACTCTCTCACCAATCTCAAAACAATTCTCTCTCTCTTTATTCTTCTTCTTCAGCTTCAGATTTCAGATCTTAAATCTTCAAGTCTTCTTCTTCTTCTTCTGCAACCATGGCTATGCAGGAACGTTGTGAGAGTTTATGTTCTGATGAACTTATATCTTCCTCAGATGCCTTTTACCTCAAGACAAGAAAGCCTTATACCATCACTAAACAAAGAGAGAAATGGACAGAAGCAGAGCATGAGAAGTTTGTAGAAGCATTGAAACTCTATGGCAGAGCTTGGAGACGAATCGAAGAACATGTTGGAACAAAAACTGCAGTTCAGATTCGAAGCCATGCGCAGAAGTTCTTTACTAAGGTTGCTCGCGATTTTGGTGTTAGCTCTGAGTCCATTGAGATCCCGCCTCCAAGGCCAAAGAGAAAGCCGATGCATCCTTACCCTAGAAAGCTTGTGATTCCTGATGCAAAAGAGATGGTATACGCTGAACTAACCGGATCCAAGCTGATTCAGGATGAAGATAACCGATCTCCAACATCGGTTTTATCAGCTCATGGCTCAGATGGATTAGGTTCCATTGGTTCAAATTCACCTAACTCTTCTTCAGCTGAGTTATCATCTCACACAGAGGAATCATTGTCTCTAGAAGCAGAGACCAAACAGAGCCTTAAGCTCTTTGGAAAAACTTTTGTAGTTGGTGATTACAACTCTTCAATGAGTTGTGATGATTCTGAAGATGGCAAGAAGAAGCTATACTCAGAAACACAGTCTCTTCAATGTTCTTCTTCTACTTCAGAAAACGCTGAAACAGAAGTGGTAGTGTCGGAGTTCAAAAGAAGTGAGAGATCAGCTTTCTCTCAGTTAAAATCGTCGGTGACTGAGATGAACAACATGAGAGGGTTCATGCCTTACAAAAAGAGAGTAAAGGTGGAAGAAAACATTGACAATGTAAAATTATCATATCCTTTGTGGTGA
CDS Sequence
Protein Sequence