Gene Details:
- Gene ID: AT5G35750
- Gene Symbol: AHK2, HK2
- Gene Name: histidine kinase 2, histidine kinase 2
- Description: histidine kinase 2;(source:Araport11)
- TAIR Accession: locus:2177261
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0010271 — acts upstream of or within — regulation of chlorophyll catabolic process
- GO:0009909 — involved in — regulation of flower development
- GO:0070417 — involved in — cellular response to cold
- GO:0000155 — enables — phosphorelay sensor kinase activity
- GO:0005515 — enables — protein binding
- GO:0071215 — involved in — cellular response to abscisic acid stimulus
- GO:0000160 — involved in — phosphorelay signal transduction system
- GO:0048509 — involved in — regulation of meristem development
- GO:0010029 — acts upstream of or within — regulation of seed germination
- GO:0019900 — enables — kinase binding
- GO:0009884 — enables — cytokinin receptor activity
- GO:0009736 — acts upstream of or within — cytokinin-activated signaling pathway
- GO:0043424 — enables — protein histidine kinase binding
- GO:0004673 — enables — protein histidine kinase activity
- GO:0010087 — involved in — phloem or xylem histogenesis
- GO:0034757 — involved in — negative regulation of iron ion transport
- GO:0009414 — acts upstream of or within — response to water deprivation
- GO:0009651 — acts upstream of or within — response to salt stress
- GO:0048831 — acts upstream of or within — regulation of shoot system development
- GO:0006970 — acts upstream of or within — response to osmotic stress
- GO:0009737 — acts upstream of or within — response to abscisic acid
- GO:0009636 — involved in — response to toxic substance
- GO:0042802 — enables — identical protein binding
- GO:0005886 — located in — plasma membrane
- GO:0005034 — enables — osmosensor activity
- GO:0080117 — involved in — secondary growth
Function-related keywords:
Literature:
- The Arabidopsis AHK4 histidine kinase is a cytokinin-binding receptor that transduces cytokinin signals across the membrane. DOI: 10.1093/pcp/pce127 ; PMID: 11577198
- The AHK4 gene involved in the cytokinin-signaling pathway as a direct receptor molecule in Arabidopsis thaliana. DOI: 10.1093/pcp/pce094 ; PMID: 11479382
- The Arabidopsis sensor His-kinase, AHk4, can respond to cytokinins. DOI: 10.1093/pcp/pce037 ; PMID: 11230563
- Novel family of sensor histidine kinase genes in Arabidopsis thaliana. DOI: 10.1093/pcp/pce015 ; PMID: 11230578
- Two-component signal transduction pathways in Arabidopsis. DOI: 10.1104/pp.005504 ; PMID: 12068096
- His-Asp phosphorelay signal transduction in higher plants: receptors and response regulators for cytokinin signaling in Arabidopsis thaliana. DOI: 10.1266/ggs.77.383 ; PMID: 12589073
- Cytokinin signal transduction in plant cells. DOI: 10.1007/s10265-003-0094-6 ; PMID: 12836044
- Histidine kinase homologs that act as cytokinin receptors possess overlapping functions in the regulation of shoot and root growth in Arabidopsis. DOI: 10.1105/tpc.021477 ; PMID: 15155880
- In planta functions of the Arabidopsis cytokinin receptor family. DOI: 10.1073/pnas.0402887101 ; PMID: 15166290
- Interaction between phosphate-starvation, sugar, and cytokinin signaling in Arabidopsis and the roles of cytokinin receptors CRE1/AHK4 and AHK3. DOI: 10.1104/pp.105.060517 ; PMID: 15923327
- Arabidopsis cytokinin receptor mutants reveal functions in shoot growth, leaf senescence, seed size, germination, root development, and cytokinin metabolism. DOI: 10.1105/tpc.105.037796 ; PMID: 16361392
- Cytokinin receptors are required for normal development of auxin-transporting vascular tissues in the hypocotyl but not in adventitious roots. DOI: 10.1093/pcp/pci240 ; PMID: 16357038
- Cytokinins regulate a bidirectional phosphorelay network in Arabidopsis. DOI: 10.1016/j.cub.2006.04.030 ; PMID: 16753566
- Cytokinin receptors are involved in alkamide regulation of root and shoot development in Arabidopsis. DOI: 10.1104/pp.107.107953 ; PMID: 17965178
- Identification of amino acid substitutions that render the Arabidopsis cytokinin receptor histidine kinase AHK4 constitutively active. DOI: 10.1093/pcp/pcm145 ; PMID: 17956858
- Three type-B response regulators, ARR1, ARR10 and ARR12, play essential but redundant roles in cytokinin signal transduction throughout the life cycle of Arabidopsis thaliana. DOI: 10.1093/pcp/pcm165 ; PMID: 18037673
- Functional analysis of AHK1/ATHK1 and cytokinin receptor histidine kinases in response to abscisic acid, drought, and salt stress in Arabidopsis. DOI: 10.1073/pnas.0706547105 ; PMID: 18077346
- Zeatin-induced nitric oxide (NO) biosynthesis in Arabidopsis thaliana mutants of NO biosynthesis and of two-component signaling genes. DOI: 10.1111/j.1469-8137.2008.02383.x ; PMID: 18298431
- Toward an interaction map of the two-component signaling pathway of Arabidopsis thaliana. DOI: 10.1021/pr0703831 ; PMID: 18642946
- Type B response regulators of Arabidopsis play key roles in cytokinin signaling and plant development. DOI: 10.1105/tpc.108.059584 ; PMID: 18723577
- The role of auxins and cytokinins in the mutualistic interaction between Arabidopsis and Piriformospora indica. DOI: 10.1094/MPMI-21-10-1371 ; PMID: 18785832
- Reproductive organs regulate leaf nitrogen metabolism mediated by cytokinin signal. DOI: 10.1007/s00425-008-0858-2 ; PMID: 19048287
- The histidine kinases CYTOKININ-INDEPENDENT1 and ARABIDOPSIS HISTIDINE KINASE2 and 3 regulate vascular tissue development in Arabidopsis shoots. DOI: 10.1105/tpc.109.066696 ; PMID: 19622803
- Cytokinin overproduction-caused alteration of flower development is partially mediated by CUC2 and CUC3 in Arabidopsis. DOI: 10.1016/j.gene.2009.11.003 ; PMID: 19913077
- STIMPY mediates cytokinin signaling during shoot meristem establishment in Arabidopsis seedlings. DOI: 10.1242/dev.041426 ; PMID: 20110319
- A subset of cytokinin two-component signaling system plays a role in cold temperature stress response in Arabidopsis. DOI: 10.1074/jbc.M109.096644 ; PMID: 20463025
- E. coli-based cell-free expression, purification and characterization of the membrane-bound ligand-binding CHASE-TM domain of the cytokinin receptor CRE1/AHK4 of Arabidopsis thaliana. DOI: 10.1007/s12033-010-9331-0 ; PMID: 20886313
- The specificity of cytokinin signalling in Arabidopsis thaliana is mediated by differing ligand affinities and expression profiles of the receptors. DOI: 10.1111/j.1365-313X.2011.04584.x ; PMID: 21426428
- Autophosphorylation profiling of Arabidopsis protein kinases using the cell-free system. DOI: 10.1016/j.phytochem.2011.02.029 ; PMID: 21477822
- The cytokinin receptors of Arabidopsis are located mainly to the endoplasmic reticulum. DOI: 10.1104/pp.111.180539 ; PMID: 21709172
- Bacterial assay to study plant sensor histidine kinases. DOI: 10.1007/978-1-61779-264-9_7 ; PMID: 21837564
- N-glucosyltransferase UGT76C2 is involved in cytokinin homeostasis and cytokinin response in Arabidopsis thaliana. DOI: 10.1093/pcp/pcr152 ; PMID: 22051886
- Programmed cell death induced by high levels of cytokinin in Arabidopsis cultured cells is mediated by the cytokinin receptor CRE1/AHK4. DOI: 10.1093/jxb/ers008 ; PMID: 22312114
- Cytokinin receptor-dependent and receptor-independent pathways in the dehydration response of Arabidopsis thaliana. DOI: 10.1016/j.jplph.2012.05.007 ; PMID: 22704545
- Arabidopsis response Regulator1 and Arabidopsis histidine phosphotransfer Protein2 (AHP2), AHP3, and AHP5 function in cold signaling. DOI: 10.1104/pp.112.207621 ; PMID: 23124324
- A novel protective function for cytokinin in the light stress response is mediated by the Arabidopsis histidine kinase2 and Arabidopsis histidine kinase3 receptors. DOI: 10.1104/pp.113.224667 ; PMID: 24424319
- Lateral root formation and growth of Arabidopsis is redundantly regulated by cytokinin metabolism and signalling genes. DOI: 10.1093/jxb/ert291 ; PMID: 24023250
- Involvement of two-component signalling systems in the regulation of stomatal aperture by light in Arabidopsis thaliana. DOI: 10.1111/nph.12813 ; PMID: 24758561
- Stress physiology functions of the Arabidopsis histidine kinase cytokinin receptors. DOI: 10.1111/ppl.12290 ; PMID: 25263537
- and AHK3-like cytokinin receptors in Brassica napus reveals two subfamilies of AHK2 orthologues. DOI: 10.1093/jxb/eru422 ; PMID: 25336686
- Plant membrane assays with cytokinin receptors underpin the unique role of free cytokinin bases as biologically active ligands. DOI: 10.1093/jxb/eru522 ; PMID: 25609827
- The Sensor Histidine Kinases AHK2 and AHK3 Proceed into Multiple Serine/Threonine/Tyrosine Phosphorylation Pathways in Arabidopsis thaliana. DOI: 10.1016/j.molp.2015.10.002 ; PMID: 26485051
- Volatile compounds emitted by diverse phytopathogenic microorganisms promote plant growth and flowering through cytokinin action. DOI: 10.1111/pce.12759 ; PMID: 27092473
- Cytokinin Regulates the Etioplast-Chloroplast Transition through the Two-Component Signaling System and Activation of Chloroplast-Related Genes. DOI: 10.1104/pp.16.00640 ; PMID: 27388681
- Plastid osmotic stress influences cell differentiation at the plant shoot apex. DOI: 10.1242/dev.136234 ; PMID: 27510974
- Gain-of-Function Mutants of the Cytokinin Receptors AHK2 and AHK3 Regulate Plant Organ Size, Flowering Time and Plant Longevity. DOI: 10.1104/pp.16.01903 ; PMID: 28096190
- Opposite roles of the Arabidopsis cytokinin receptors AHK2 and AHK3 in the expression of plastid genes and genes for the plastid transcriptional machinery during senescence. DOI: 10.1007/s11103-016-0580-6 ; PMID: 28150126
- Divergent expression of cytokinin biosynthesis, signaling and catabolism genes underlying differences in feeding sites induced by cyst and root-knot nematodes. DOI: 10.1111/tpj.13647 ; PMID: 28746737
- Cytokinin activity of N(6)-benzyladenine derivatives assayed by interaction with the receptors in planta, in vitro, and in silico. DOI: 10.1016/j.phytochem.2018.02.008 ; PMID: 29544164
- Crosstalk between the cytokinin and MAX2 signaling pathways in growth and callus formation of Arabidopsis thaliana. DOI: 10.1016/j.bbrc.2019.02.038 ; PMID: 30795866
- The role of cytokinin in selenium stress response in Arabidopsis. DOI: 10.1016/j.plantsci.2019.01.028 ; PMID: 30824045
- Nitrate Induction of Primary Root Growth Requires Cytokinin Signaling in Arabidopsis thaliana. DOI: 10.1093/pcp/pcz199 ; PMID: 31730198
- Studies of cytokinin receptor-phosphotransmitter interaction provide evidences for the initiation of cytokinin signalling in the endoplasmic reticulum. DOI: 10.1071/FP16292 ; PMID: 32291033
- Photoperiod stress induces an oxidative burst-like response and is associated with increased apoplastic peroxidase and decreased catalase activities. DOI: 10.1016/j.jplph.2020.153252 ; PMID: 32949889
- Azospirillum brasilense Sp245 triggers cytokinin signaling in root tips and improves biomass accumulation in Arabidopsis through canonical cytokinin receptors. DOI: 10.1007/s12298-021-01036-9 ; PMID: 34539107
- Root-specific Reduction of Cytokinin Perception Enhances Shoot Growth in Arabidopsis thaliana. DOI: 10.1093/pcp/pcac013 ; PMID: 35134216
- Back From the Dead: The Atypical Kinase Activity of a Pseudokinase Regulator of Cation Fluxes During Inducible Immunity. DOI: 10.3389/fpls.2022.931324 ; PMID: 36035673
- In Planta, In Vitro and In Silico Studies of Chiral N(6)-Benzyladenine Derivatives: Discovery of Receptor-Specific S-Enantiomers with Cytokinin or Anticytokinin Activities. DOI: 10.3390/ijms231911334 ; PMID: 36232653
- The Role of a Cytokinin Antagonist in the Progression of Clubroot Disease. DOI: 10.3390/biom13020299 ; PMID: 36830668
- Reproductive organs regulate leaf nitrogen metabolism mediated by cytokinin signal. DOI: 10.1007/s00425-008-0858-2 ; PMID: 19048287
Sequences:
cDNA Sequence
- >AT5G35750.1
AGAAGAGAGAAGTGACATTCTTTTTCTTTAGCTCATAATTTCTCTAACAAATGCTTCTTTTATCCAAACTCTGATCATTGAGTCCAGTTGGGTAATGAGAGACACCAGCTGGGTTTCTTTTGTTTAAGCTCACAAACATCTAAAACAGAGAAAGCTTTGTCATTTTTCTTTACCCTGAAACCATGAAAGAAGATAAAGCTTTGTCCTTTTTCTCTTTTCCGTTTCTTTACTCTCAACAATGTCTTCTTTCTCCCATTGCAACAACCACTGGGTTTGGTTCATCTTGTCCTCTTGCGTCTTAAGTAAGAAAAAAGAAAAAAGCTTTGCGTTTGGGACTATGTCACAGCTTCTTGTTCTTCTTGTGGATGGTTTCAAGAACTCAACTATGAGATTGTTGTTGATAGAGTTTTAGTTTTGGGTTTGAAGAGATCTGAATTTCTTCAGCTGAATCTGAGATTAGGAGTCGAAATGTCTATAACTTGTGAGCTCTTGAATCTTACTTCAAAGAAAGCTAAGAAGTCGTCGAGCAGTGACAAGAAATGGCTAAAGAAGCCTCTCTTCTTCCTGATTTTGTGTGGCTCTTTGGTAATTGTTTTGGTTATGTTCTTACGGTTAGGTAGAAGTCAGAAGGAGGAGACAGATTCTTGTAATGGAGAAGAGAAAGTGTTGTATAGACATCAAAATGTCACAAGAAGTGAGATTCATGATTTGGTCTCTTTGTTCTCTGATTCAGATCAGGTAACATCCTTTGAATGTCATAAGGAATCAAGCCCTGGAATGTGGACAAACTATGGTATTACATGTTCCCTGAGTGTGCGTTCTGATAAACAAGAGACTAGAGGGCTTCCCTGGAATCTTGGCTTAGGACATTCTATCTCATCAACATCTTGTATGTGTGGTAATCTTGAACCGATTTTACAGCAACCTGAAAACCTTGAGGAAGAAAACCATGAAGAAGGGCTGGAGCAGGGTTTGTCATCGTATTTAAGAAATGCATGGTGGTGTCTAATCCTTGGTGTGTTAGTGTGCCATAAGATTTATGTATCTCATTCTAAAGCACGAGGTGAGAGGAAAGAGAAAGTACATCTGCAAGAGGCTTTAGCTCCAAAGAAGCAGCAACAACGTGCTCAGACTTCTTCTAGAGGGGCTGGAAGATGGAGGAAGAATATCCTTCTCCTTGGTATTTTAGGAGGAGTTTCCTTCTCTGTTTGGTGGTTTTGGGACACTAATGAGGAGATCATAATGAAAAGGAGGGAGACTTTGGCAAACATGTGTGACGAACGAGCACGTGTTTTACAAGATCAGTTCAATGTTAGCTTGAACCATGTTCATGCCTTGTCTATTCTTGTATCTACATTTCATCATGGTAAAATCCCATCTGCCATTGATCAGAGAACATTTGAAGAATATACTGAGAGAACAAACTTTGAGAGGCCACTTACTAGTGGTGTAGCGTATGCTTTGAAAGTCCCACACTCAGAAAGAGAGAAATTTGAAAAGGAGCATGGATGGGCAATAAAGAAAATGGAAACTGAGGACCAGACAGTTGTACAAGATTGTGTTCCTGAAAACTTTGATCCCGCACCGATTCAAGACGAATACGCGCCAGTTATATTTGCTCAAGAAACTGTTTCCCATATTGTATCGGTCGACATGATGTCTGGAGAAGAAGACCGTGAAAACATCTTACGGGCAAGGGCATCAGGAAAAGGAGTGTTAACATCTCCATTTAAGCTTCTTAAGTCAAATCATCTTGGTGTTGTGTTGACCTTTGCTGTCTATGACACGAGCCTACCGCCTGATGCTACAGAAGAACAGCGTGTTGAAGCAACTATTGGGTACCTTGGTGCATCATATGATATGCCATCGCTGGTGGAGAAACTTCTTCACCAACTTGCCAGCAAACAGACAATTGCTGTGGATGTTTACGACACAACTAACACTTCAGGTCTAATAAAAATGTATGGCTCAGAAATTGGGGATATAAGTGAGCAGCATATAAGTAGCCTTGATTTTGGTGATCCATCAAGGAACCATGAGATGCATTGCAGGTTTAAGCATAAACTTCCCATTCCCTGGACAGCGATAACACCGTCGATCTTAGTTCTGGTTATTACTTTTCTTGTTGGTTATATTTTATATGAAGCCATCAACCGAATTGCGACAGTTGAAGAGGATTGTCAGAAGATGAGGGAACTCAAAGCTCGTGCTGAGGCCGCTGACATTGCAAAGTCACAGTTCCTAGCAACTGTTTCTCATGAGATACGGACTCCGATGAATGGAGTTTTAGGAATGCTGAAAATGCTGATGGACACCGATCTTGATGCGAAGCAGATGGACTATGCGCAAACTGCTCATGGCAGTGGGAAGGATCTTACATCACTAATAAATGAGGTTCTTGATCAGGCAAAGATTGAATCCGGAAGGCTCGAGCTTGAAAATGTGCCTTTTGATATGCGTTTTATTCTTGATAATGTTTCATCTCTCCTCTCTGGCAAGGCAAATGAAAAAGGAATTGAGTTGGCCGTTTATGTTTCTAGTCAAGTTCCTGATGTTGTAGTCGGTGATCCGAGTCGGTTCCGGCAGATCATTACAAACCTGGTTGGAAACTCAATCAAATTCACACAGGAAAGGGGACACATATTTATCTCAGTGCACCTTGCAGATGAGGTAAAGGAGCCTCTTACTATTGAAGACGCAGTGCTAAAACAGCGACTAGCTTTAGGATGCAGCGAGTCCGGTGAGACAGTTAGCGGGTTTCCTGCGGTAAATGCATGGGGAAGCTGGAAGAATTTCAAGACATGTTACAGTACTGAGAGTCAGAATTCTGATCAAATCAAATTGCTAGTTACAGTGGAGGACACTGGAGTTGGCATACCTGTGGATGCACAAGGCCGAATCTTCACACCTTTTATGCAAGCCGACAGTTCCACATCGCGGACTTATGGTGGAACTGGCATAGGTTTGAGTATAAGCAAACGTTTGGTTGAACTCATGCAAGGAGAGATGGGGTTTGTGAGTGAGCCCGGGATAGGCAGTACTTTTTCATTTACTGGAGTTTTCGGGAAAGCAGAAACAAATACGTCGATTACTAAGCTGGAACGATTCGATCTAGCTATTCAGGAGTTTACAGGATTGAGAGCATTAGTTATTGATAACAGAAACATTAGAGCAGAGGTCACCAGGTACGAACTTCGGAGACTGGGAATATCTGCAGACATTGTTTCAAGTCTGAGAATGGCATGCACTTGTTGTATCAGCAAATTAGAAAATTTGGCTATGATTCTAATAGACAAAGACGCCTGGAACAAGGAAGAATTTTCAGTACTTGACGAGTTGTTTACCCGAAGCAAAGTAACCTTTACAAGAGTCCCAAAGATTTTTCTTTTGGCAACTTCTGCAACTCTTACTGAGCGCAGTGAGATGAAGTCTACTGGTCTCATCGATGAGGTGGTGATAAAGCCTCTTCGGATGAGTGTCTTAATATGTTGCTTGCAAGAAACCCTTGTCAATGGCAAGAAGAGGCAACCGAACAGACAGCGAAGAAATCTTGGACACTTGCTAAGAGAAAAACAGATTCTGGTTGTGGATGATAATCTTGTGAACAGACGAGTTGCAGAAGGTGCACTTAAGAAATATGGAGCTATTGTTACATGCGTTGAGAGTGGCAAAGCTGCATTGGCAATGCTTAAGCCGCCTCATAACTTCGATGCTTGCTTCATGGATCTCCAGATGCCTGAAATGGATGGATTTGAAGCGACAAGGAGAGTCCGTGAGCTGGAGAGGGAAATCAATAAGAAAATAGCTTCTGGAGAAGTTTCAGCTGAAATGTTCTGTAAATTTAGTAGTTGGCACGTCCCGATATTAGCAATGACAGCAGATGTTATTCAGGCTACTCATGAAGAATGCATGAAATGTGGAATGGATGGTTATGTATCAAAACCGTTTGAAGAGGAAGTGCTCTACACAGCGGTAGCAAGATTCTTTGAACCTTGTTAAAAGAAAAAGCCATTTCCCTTGTAGGATTATATATCAACCCGAGAGCTTTTTGACATCGGGTAGTATATCTTGAACATCCATGACCTGCAATTCAACTTGAGATCAAGGCAAGAACCAGTTCATTGTCAATTTTTCTTCACAGGTCTCTTTCAGCTTAAGACCTCGTCTGGTTGAGTGAGAAAAACTGCGAAAACCGATCTTTCTCTTTGTATAGACACTTTGTCTTCATTGATCTCTGCCTGTGTGTATAGTAGATTCCTAGGGTATAGCTCCATTATATTCATTTTATATATATATAAACCCAAACTCTGTCCTCTTAACTATGAAACAGCTTGTATATTGTGTAGTAATAGTAATGGCTCTTGATTACATGATAGGAAGCGTATAAATGACAGTGTGTTCTGAAAAGCTTCCAGAAGCAGAACAAAATCTTCCTCAAAAGTCAAAACCAATGCAGATC
CDS Sequence
Protein Sequence