Gene Details:
- Gene ID: AT5G35590
- Gene Symbol: PAA1
- Gene Name: proteasome alpha subunit A1
- Description: proteasome alpha subunit A1;(source:Araport11)
- TAIR Accession: locus:2157106
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0010498 — involved in — proteasomal protein catabolic process
- GO:0005829 — located in — cytosol
- GO:0006511 — acts upstream of or within — ubiquitin-dependent protein catabolic process
- GO:0010043 — acts upstream of or within — response to zinc ion
- GO:0000502 — part of — proteasome complex
- GO:0000325 — located in — plant-type vacuole
- GO:0006511 — involved in — ubiquitin-dependent protein catabolic process
- GO:0019773 — part of — proteasome core complex, alpha-subunit complex
- GO:0005839 — part of — proteasome core complex
- GO:0009507 — located in — chloroplast
- GO:0005634 — is active in — nucleus
- GO:0009536 — located in — plastid
Function-related keywords:
Literature:
- Structure and functional analysis of the 26S proteasome subunits from plants. DOI: 10.1023/a:1006926322501 ; PMID: 10363660
- Molecular organization of the 20S proteasome gene family from Arabidopsis thaliana. DOI: 10.1093/genetics/149.2.677 ; PMID: 9611183
- The 20S proteasome gene family in Arabidopsis thaliana. DOI: 10.1016/s0014-5793(97)01228-3 ; PMID: 9373170
- OrthoParaMap: distinguishing orthologs from paralogs by integrating comparative genome data and gene phylogenies. DOI: 10.1186/1471-2105-4-35 ; PMID: 12952558
- Stress-induced protein S-glutathionylation in Arabidopsis. DOI: 10.1104/pp.104.058917 ; PMID: 16055689
- Proteomic investigation of the effect of salicylic acid on Arabidopsis seed germination and establishment of early defense mechanisms. DOI: 10.1104/pp.106.082057 ; PMID: 16679420
- A predicted interactome for Arabidopsis. DOI: 10.1104/pp.107.103465 ; PMID: 17675552
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Identification of zinc-responsive proteins in the roots of Arabidopsis thaliana using a highly improved method of two-dimensional electrophoresis. DOI: 10.1093/pcp/pcp154 ; PMID: 19880396
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- Gene expression profiling analysis of copper homeostasis in Arabidopsis thaliana. DOI: 10.1016/j.bbrc.2010.01.111 ; PMID: 20117084
- Affinity purification of the Arabidopsis 26 S proteasome reveals a diverse array of plant proteolytic complexes. DOI: 10.1074/jbc.M110.136622 ; PMID: 20516081
- Structure, function and regulation of plant proteasomes. DOI: 10.1016/j.biochi.2007.07.019 ; PMID: 17825468
- The m(6) A reader ECT2 post-transcriptionally regulates proteasome activity in Arabidopsis. DOI: 10.1111/nph.16660 ; PMID: 32416015
- Structure and functional analysis of the 26S proteasome subunits from plants. DOI: 10.1023/a:1006926322501 ; PMID: 10363660
- The 20S proteasome gene family in Arabidopsis thaliana. DOI: 10.1016/s0014-5793(97)01228-3 ; PMID: 9373170
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequences:
cDNA Sequence
- >AT5G35590.1
AAACACCACCTCGACTCTTTTTTTCTTCTGTCTTGGACATAAAGCTTGATTCAATTCCATTCCTTATTGTTATATACACATCTCTGATTCAACTCCACCGAATTCAGAAGATCGAAGAAGATGAGTAGAGGAAGCGGCGCTGGTTATGATCGTCACATCACTATCTTCTCACCGGAAGGTCGTCTCTTTCAAGTTGAATATGCCTTCAAGGCCGTGAAAACAGCTGGTATTACTTCAATCGGAGTTCGTGGGAAAGATTCGGTTTGCGTCGTTACCCAGAAGAAAGTTCCTGACAAGCTTTTGGATCAGTCTAGTGTTACACATCTGTTCCCTATCACCAAGTACATTGGATTGGTAGCTACTGGCATTACAGCTGATGCAAGGTCTTTGGTTCAACAAGCAAGGAATCAAGCAGCTGAATTTCGGTTCACTTATGGATATGAGATGCCTGTTGACATTCTTGCTAAATGGATAGCGGACAAGTCACAGGTCTACACTCAACATGCTTACATGAGACCCCTTGGAGTTGTCGCTATGGTAATGGGTGTTGATGAAGAGAATGGTCCCTTACTTTACAAATGTGACCCAGCTGGACATTTTTACGGTCACAAGGCAACTAGTGCTGGTATGAAGGAACAAGAAGCAGTCAATTTCTTGGAGAAGAAAATGAAAGAAAACCCATCTTTCACATTTGATGAAACCGTGCAGACTGCCATATCGGCTTTGCAATCTGTTCTTCAAGAAGACTTCAAGGCTACTGAGATTGAGGTAGGTGTGGTGAGAGCAGAGAACCCGGAATTCCGTGCATTGACAACGGAGGAGATTGAGGAGCATTTGACAGCCATTAGTGAACGAGACTGATCAACTTAGTGAAACAAGTGTGAGTTACGTTGCTTCGCTTCTATCAGACATTCCTCTAAAGTGACCACTCTCCATCGATCTTTTGTTTGGTCTTCCTTCCATAATTTAATTTACTTAGTCAACCCAGCAAACTTGAAAAACAAAAATGCACTGTAATGCTTAAGGCTGTGAGAGTTTCCGAGTCTTTTGACTCTTCAGAAATGACACCAACTTTACTCATATCATCACTTTCTAGCTTTTTATTTCTATCGTTGCAGTTGCTGTGTCTTCGTCTTCACCAGTTCTTAAACTCGAATTCGTTTTAAGGTTTCAGTTGTTAGAAAGTGAGGGATCATTCTTAC
CDS Sequence
Protein Sequence