Information report for AT5G35550
Gene Details
|
|
Functional Descriptions
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0005515 — enables — protein binding
- GO:0010023 — acts upstream of or within — proanthocyanidin biosynthetic process
- GO:0006633 — acts upstream of or within — fatty acid biosynthetic process
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0030154 — involved in — cell differentiation
- GO:0005634 — is active in — nucleus
- GO:0005634 — located in — nucleus
- GO:0006355 — involved in — regulation of DNA-templated transcription
- GO:0006970 — acts upstream of or within — response to osmotic stress
Functional Keywords
Literature and News
- The TT8 gene encodes a basic helix-loop-helix domain protein required for expression of DFR and BAN genes in Arabidopsis siliques. DOI: 10.1105/tpc.12.10.1863 ; PMID: 11041882
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The R2R3-MYB gene family in Arabidopsis thaliana. DOI: 10.1016/s1369-5266(00)00199-0 ; PMID: 11597504
- The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. DOI: 10.1105/tpc.010098 ; PMID: 11549766
- Metabolic engineering of proanthocyanidins by ectopic expression of transcription factors in Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2005.02510.x ; PMID: 16167896
- TT8 controls its own expression in a feedback regulation involving TTG1 and homologous MYB and bHLH factors, allowing a strong and cell-specific accumulation of flavonoids in Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2006.02733.x ; PMID: 16709193
- Arabidopsis TRANSPARENT TESTA GLABRA2 is directly regulated by R2R3 MYB transcription factors and is involved in regulation of GLABRA2 transcription in epidermal differentiation. DOI: 10.1105/tpc.107.052274 ; PMID: 17766401
- TTG1 complex MYBs, MYB5 and TT2, control outer seed coat differentiation. DOI: 10.1016/j.ydbio.2008.10.005 ; PMID: 18992236
- The promoter of the Arabidopsis thaliana BAN gene is active in proanthocyanidin-accumulating cells of the Brassica napus seed coat. DOI: 10.1007/s00299-008-0667-x ; PMID: 19153740
- Architectural phenotypes in the transparent testa mutants of Arabidopsis thaliana. DOI: 10.1093/jxb/ern323 ; PMID: 19129166
- A WD40-repeat gene from Malus x domestica is a functional homologue of Arabidopsis thaliana TRANSPARENT TESTA GLABRA1. DOI: 10.1007/s00299-010-0821-0 ; PMID: 20107808
- TRANSPARENT TESTA1 interacts with R2R3-MYB factors and affects early and late steps of flavonoid biosynthesis in the endothelium of Arabidopsis thaliana seeds. DOI: 10.1111/j.1365-313X.2011.04603.x ; PMID: 21477081
- A new system for fast and quantitative analysis of heterologous gene expression in plants. DOI: 10.1111/j.1469-8137.2011.03936.x ; PMID: 22023451
- Proanthocyanidins inhibit seed germination by maintaining a high level of abscisic acid in Arabidopsis thaliana. DOI: 10.1111/j.1744-7909.2012.01142.x ; PMID: 22765383
- Identification of key amino acids for the evolution of promoter target specificity of anthocyanin and proanthocyanidin regulating MYB factors. DOI: 10.1007/s11103-013-0074-8 ; PMID: 23689818
- The TRANSPLANTA collection of Arabidopsis lines: a resource for functional analysis of transcription factors based on their conditional overexpression. DOI: 10.1111/tpj.12443 ; PMID: 24456507
- TRANSPARENT TESTA2 regulates embryonic fatty acid biosynthesis by targeting FUSCA3 during the early developmental stage of Arabidopsis seeds. DOI: 10.1111/tpj.12426 ; PMID: 24397827
- Starting to gel: how Arabidopsis seed coat epidermal cells produce specialized secondary cell walls. DOI: 10.3390/ijms16023452 ; PMID: 25658798
- The rolB gene activates secondary metabolism in Arabidopsis calli via selective activation of genes encoding MYB and bHLH transcription factors. DOI: 10.1016/j.plaphy.2016.02.015 ; PMID: 26913794
- Two IIIf Clade-bHLHs from Freesia hybrida Play Divergent Roles in Flavonoid Biosynthesis and Trichome Formation when Ectopically Expressed in Arabidopsis. DOI: 10.1038/srep30514 ; PMID: 27465838
- Characterization of the cis elements in the proximal promoter regions of the anthocyanin pathway genes reveals a common regulatory logic that governs pathway regulation. DOI: 10.1093/jxb/erv173 ; PMID: 25911741
- Site-specific phosphorylation of TRANSPARENT TESTA GLABRA1 mediates carbon partitioning in Arabidopsis seeds. DOI: 10.1038/s41467-018-03013-5 ; PMID: 29422671
- Insights into the role of transcription factors controlling mucilage production in the Arabidopsis seed coat. DOI: 10.1016/j.plantsci.2018.04.021 ; PMID: 29807590
- MYB-bHLH-TTG1 Regulates Arabidopsis Seed Coat Biosynthesis Pathways Directly and Indirectly via Multiple Tiers of Transcription Factors. DOI: 10.1093/pcp/pcaa027 ; PMID: 32154880
- The Seed Development Factors TT2 and MYB5 Regulate Heat Stress Response in Arabidopsis. DOI: 10.3390/genes12050746 ; PMID: 34063415
- ARF2 positively regulates flavonols and proanthocyanidins biosynthesis in Arabidopsis thaliana. DOI: 10.1007/s00425-022-03936-w ; PMID: 35857143
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
Gene Resources
- UniProt: A0A1P8BFG0
- EMBL: CP002688
- AlphaFoldDB: A0A1P8BFG0
- EnsemblPlants: AT5G35550.2
- Gramene: AT5G35550.2
- ExpressionAtlas: AT5G35550
- InterPro: IPR001005, IPR009057, IPR015495
- PANTHER: PTHR47998, PTHR47998:SF74
- SUPFAM: SSF46689
- PROSITE: PS50090, PS51294
- Gene3D: 1.10.10.60
- SWISS-MODEL: A0A1P8BFG0
- Conserved Domain Database: cd00167
Sequences
cDNA Sequence
- >AT5G35550.2
TTCTCAACACAACACTAAAGACAATTGTACCAACCACACAACCACAAGAGAGAGAAAAGTGAGAATGGGAAAGAGAGCAACTACTAGTGTGAGGAGAGAAGAGTTAAACAGAGGAGCTTGGACTGATCATGAAGACAAGATCCTTAGAGATTACATCACCACTCACGGCGAAGGCAAATGGAGCACTCTCCCTAACCAAGCTGGTACTAATCTCTCTATCTACCGATCCGTCTTTATATCTTCTACGTACAATAATTGTCTTGGCACACATAAAAGGTCTCAAGAGGTGTGGCAAAAGCTGTAGACTTCGGTGGAAGAACTACCTAAGACCGGGGATAAAGCGCGGTAACATCTCATCTGATGAAGAAGAACTCATAATCCGTCTCCATAATCTTCTTGGAAACAGATGGTCGTTGATAGCTGGGAGGCTTCCAGGCCGAACAGACAATGAAATAAAGAATCATTGGAACTCAAACCTCCGCAAAAGACTTCCCAAAACTCAAACCAAGCAACCAAAACGTATAAAACATTCGACGAACAACGAGAATAATGTATGTGTTATACGTACAAAGGCGATTAGGTGCTCAAAGACTCTTCTCTTCTCGGATCTCTCTCTTCAGAAGAAGAGTAGTACTAGTCCACTACCTCTGAAAGAACAAGAGATGGATCAAGGTGGATCTTCGTTGATGGGAGATCTCGAATTCGATTTCGATAGGATCCATTCGGAGTTTCACTTCCCGGATTTGATGGATTTTGATGGTTTGGACTGTGGAAACGTTACATCTCTTGTTTCATCTAACGAGATTTTGGGAGAGTTGGTTCCTGCTCAAGGTAATCTCGATCTCAATAGACCTTTCACTTCTTGTCATCATCGTGGCGACGATGAAGATTGGCTCCGAGACTTCACTTGTTGAGCCTATATTGCAAAAACCTACGTTAATACATATTTCTCTATACGGACAAAAGTATATCTGTATTTGTCTGAACGCTTCTAATTACTAACTTACTAAGGAGACCAAGAAATACAAATAATTATACGATCCACATGTTATAGAAATGGGTTTTGTCTTTAACTAATAATTTTTTATTATTGCAAATACGTACGACATAAATATTTTTGATAGATTTTGTAAATTTATGTATGAG - >AT5G35550.1
TTCTCAACACAACACTAAAGACAATTGTACCAACCACACAACCACAAGAGAGAGAAAAGTGAGAATGGGAAAGAGAGCAACTACTAGTGTGAGGAGAGAAGAGTTAAACAGAGGAGCTTGGACTGATCATGAAGACAAGATCCTTAGAGATTACATCACCACTCACGGCGAAGGCAAATGGAGCACTCTCCCTAACCAAGCTGGTACTAATCTCTCTATCTACCGATCCGTCTTTATATCTTCTACGTACAATAATTGTCTTGGCACACATAAAAGGTCTCAAGAGGTGTGGCAAAAGCTGTAGACTTCGGTGGAAGAACTACCTAAGACCGGGGATAAAGCGCGGTAACATCTCATCTGATGAAGAAGAACTCATAATCCGTCTCCATAATCTTCTTGGAAACAGATGGTCGTTGATAGCTGGGAGGCTTCCAGGCCGAACAGACAATGAAATAAAGAATCATTGGAACTCAAACCTCCGCAAAAGACTTCCCAAAACTCAAACCAAGCAACCAAAACGTATAAAACATTCGACGAACAACGAGAATAATGTATGTGTTATACGTACAAAGGCGATTAGGTGCTCAAAGACTCTTCTCTTCTCGGATCTCTCTCTTCAGAAGAAGAGTAGTACTAGTCCACTACCTCTGAAAGAACAAGAGATGGATCAAGGTGGATCTTCGTTGATGGGAGATCTCGAATTCGATTTCGATAGGATCCATTCGGAGTTTCACTTCCCGGATTTGATGGATTTTGATGGTTTGGACTGTGGAAACGTTACATCTCTTGTTTCATCTAACGAGATTTTGGGAGAGTTGGTTCCTGCTCAAGGTAATCTCGATCTCAATAGACCTTTCACTTCTTGTCATCATCGTGGCGACGATGAAGATTGGCTCCGAGACTTCACTTGTTGAGCCTATATTGCAAAAACCTACGTTAATACATATTTCTCTATACGGACAAAAGTATATCTGTATTTGTCTGAACGCTTCTAATTACTAACTTACTAAGGAGACCAAGAAATACAAATAATTATACGATCCACATGTTATAGAAATGGGTTTTGTCTTTAACTAATAATTTTTTATTATTGCAAATACGTACGACATAAATATTTTTGATAGATTTTGTAAATTTATGTATGAG
CDS Sequence
Protein Sequence