Information report for AT5G35410
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- GO:0005515 — enables — protein binding
- GO:0004674 — enables — protein serine/threonine kinase activity
- GO:0009705 — located in — plant-type vacuole membrane
- GO:0006468 — involved in — protein phosphorylation
- GO:0009651 — acts upstream of or within — response to salt stress
- GO:0005737 — located in — cytoplasm
- GO:0004672 — enables — protein kinase activity
- GO:0035556 — involved in — intracellular signal transduction
- GO:0007165 — involved in — signal transduction
Functional Keywords
- root , root , plant sperm cell
Literature and News
- The Arabidopsis thaliana salt tolerance gene SOS1 encodes a putative Na+/H+ antiporter. DOI: 10.1073/pnas.120170197 ; PMID: 10823923
- The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3. DOI: 10.1073/pnas.97.7.3735 ; PMID: 10725350
- Genetic analysis of salt tolerance in arabidopsis. Evidence for a critical role of potassium nutrition. DOI: 10.1105/tpc.10.7.1181 ; PMID: 9668136
- Interaction specificity of Arabidopsis calcineurin B-like calcium sensors and their target kinases. DOI: 10.1104/pp.124.4.1844 ; PMID: 11115898
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- Ion homeostasis during salt stress in plants. DOI: 10.1016/s0955-0674(00)00227-1 ; PMID: 11454443
- Reconstitution in yeast of the Arabidopsis SOS signaling pathway for Na+ homeostasis. DOI: 10.1073/pnas.132092099 ; PMID: 12070350
- Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. DOI: 10.1046/j.1365-313x.2002.01309.x ; PMID: 12047628
- Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3. DOI: 10.1073/pnas.122224699 ; PMID: 12034882
- Regulation of expression of the vacuolar Na+/H+ antiporter gene AtNHX1 by salt stress and abscisic acid. DOI: 10.1023/a:1019859319617 ; PMID: 12369629
- The Arabidopsis CDPK-SnRK superfamily of protein kinases. DOI: 10.1104/pp.102.011999 ; PMID: 12805596
- Regulation of vacuolar Na+/H+ exchange in Arabidopsis thaliana by the salt-overly-sensitive (SOS) pathway. DOI: 10.1074/jbc.M307982200 ; PMID: 14570921
- The protein kinase SOS2 activates the Arabidopsis H(+)/Ca(2+) antiporter CAX1 to integrate calcium transport and salt tolerance. DOI: 10.1074/jbc.M309084200 ; PMID: 14583601
- Transgenic evaluation of activated mutant alleles of SOS2 reveals a critical requirement for its kinase activity and C-terminal regulatory domain for salt tolerance in Arabidopsis thaliana. DOI: 10.1105/tpc.019174 ; PMID: 14742879
- Salinity-induced ion flux patterns from the excised roots of Arabidopsis sos mutants. DOI: 10.1007/s00425-005-0074-2 ; PMID: 16079998
- Salt stress affects cortical microtubule organization and helical growth in Arabidopsis. DOI: 10.1093/pcp/pcj090 ; PMID: 16861712
- Conservation of the salt overly sensitive pathway in rice. DOI: 10.1104/pp.106.092635 ; PMID: 17142477
- SCABP8/CBL10, a putative calcium sensor, interacts with the protein kinase SOS2 to protect Arabidopsis shoots from salt stress. DOI: 10.1105/tpc.106.042291 ; PMID: 17449811
- Interaction of SOS2 with nucleoside diphosphate kinase 2 and catalases reveals a point of connection between salt stress and H2O2 signaling in Arabidopsis thaliana. DOI: 10.1128/MCB.00429-07 ; PMID: 17785451
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- The structure of the C-terminal domain of the protein kinase AtSOS2 bound to the calcium sensor AtSOS3. DOI: 10.1016/j.molcel.2007.04.013 ; PMID: 17499048
- SOS2 promotes salt tolerance in part by interacting with the vacuolar H+-ATPase and upregulating its transport activity. DOI: 10.1128/MCB.00430-07 ; PMID: 17875927
- and salt-stress signaling in plants: shedding light on SOS pathway. DOI: 10.1016/j.abb.2008.01.010 ; PMID: 18241665
- Overexpression of SOS (Salt Overly Sensitive) genes increases salt tolerance in transgenic Arabidopsis. DOI: 10.1093/mp/ssn058 ; PMID: 19529826
- Na(+)/H(+) antiporter activity of the SOS1 gene: lifetime imaging analysis and electrophysiological studies on Arabidopsis seedlings. DOI: 10.1111/j.1399-3054.2009.01274.x ; PMID: 19758408
- Regulation by salt of vacuolar H+-ATPase and H+-pyrophosphatase activities and Na+/H+ exchange. DOI: 10.4161/psb.4.8.9236 ; PMID: 19820346
- Functional analysis of TaDi19A, a salt-responsive gene in wheat. DOI: 10.1111/j.1365-3040.2009.02063.x ; PMID: 19895399
- The woody plant poplar has a functionally conserved salt overly sensitive pathway in response to salinity stress. DOI: 10.1007/s11103-010-9680-x ; PMID: 20803312
- Comparative genomic analysis of 1047 completely sequenced cDNAs from an Arabidopsis-related model halophyte, Thellungiella halophila. DOI: 10.1186/1471-2229-10-261 ; PMID: 21106055
- and K(+)-sensitive 1, regulates ion homeostasis in an SOS-independent pathway in Arabidopsis. DOI: 10.1016/j.phytochem.2010.12.005 ; PMID: 21227472
- Species specific amino acid sequence-protein local structure relationships: An analysis in the light of a structural alphabet. DOI: 10.1016/j.jtbi.2011.01.047 ; PMID: 21333657
- Activation of the plasma membrane Na/H antiporter Salt-Overly-Sensitive 1 (SOS1) by phosphorylation of an auto-inhibitory C-terminal domain. DOI: 10.1073/pnas.1018921108 ; PMID: 21262798
- Autophosphorylation profiling of Arabidopsis protein kinases using the cell-free system. DOI: 10.1016/j.phytochem.2011.02.029 ; PMID: 21477822
- Phosphorylation of SOS3-like calcium-binding proteins by their interacting SOS2-like protein kinases is a common regulatory mechanism in Arabidopsis. DOI: 10.1104/pp.111.173377 ; PMID: 21685179
- Molecular cloning and functional characterization of a novel apple MdCIPK6L gene reveals its involvement in multiple abiotic stress tolerance in transgenic plants. DOI: 10.1007/s11103-012-9899-9 ; PMID: 22382993
- Phosphorylation of calcineurin B-like (CBL) calcium sensor proteins by their CBL-interacting protein kinases (CIPKs) is required for full activity of CBL-CIPK complexes toward their target proteins. DOI: 10.1074/jbc.M111.279331 ; PMID: 22253446
- A novel protein kinase involved in Na(+) exclusion revealed from positional cloning. DOI: 10.1111/j.1365-3040.2012.02595.x ; PMID: 22897323
- Expression, purification and analysis of an Arabidopsis recombinant CBL-interacting protein kinase3 (CIPK3) and its constitutively active form. DOI: 10.1016/j.pep.2012.08.013 ; PMID: 22985939
- Release of SOS2 kinase from sequestration with GIGANTEA determines salt tolerance in Arabidopsis. DOI: 10.1038/ncomms2357 ; PMID: 23322040
- Structural insights on the plant salt-overly-sensitive 1 (SOS1) Na(+)/H(+) antiporter. DOI: 10.1016/j.jmb.2012.09.015 ; PMID: 23022605
- A role for GIGANTEA: keeping the balance between flowering and salinity stress tolerance. DOI: 10.4161/psb.24820 ; PMID: 23656866
- Co-expression of the Arabidopsis SOS genes enhances salt tolerance in transgenic tall fescue (Festuca arundinacea Schreb.). DOI: 10.1007/s00709-013-0540-9 ; PMID: 24022678
- Heterologous expression of the wheat aquaporin gene TaTIP2;2 compromises the abiotic stress tolerance of Arabidopsis thaliana. DOI: 10.1371/journal.pone.0079618 ; PMID: 24223981
- Identification of TaWD40D, a wheat WD40 repeat-containing protein that is associated with plant tolerance to abiotic stresses. DOI: 10.1007/s00299-014-1717-1 ; PMID: 25447637
- Chrysanthemum WRKY gene CmWRKY17 negatively regulates salt stress tolerance in transgenic chrysanthemum and Arabidopsis plants. DOI: 10.1007/s00299-015-1793-x ; PMID: 25893877
- CYCLIN-DEPENDENT KINASE G2 regulates salinity stress response and salt mediated flowering in Arabidopsis thaliana. DOI: 10.1007/s11103-015-0324-z ; PMID: 25948280
- Arabidopsis CALCINEURIN B-LIKE10 Functions Independently of the SOS Pathway during Reproductive Development in Saline Conditions. DOI: 10.1104/pp.16.00334 ; PMID: 26979332
- Structural basis of the regulatory mechanism of the plant CIPK family of protein kinases controlling ion homeostasis and abiotic stress. DOI: 10.1073/pnas.1407610111 ; PMID: 25288725
- EIN3 and SOS2 synergistically modulate plant salt tolerance. DOI: 10.1038/srep44637 ; PMID: 28300216
- The AtrbohF-dependent regulation of ROS signaling is required for melatonin-induced salinity tolerance in Arabidopsis. DOI: 10.1016/j.freeradbiomed.2017.04.009 ; PMID: 28412199
- A novel cotton WRKY gene, GhWRKY6-like, improves salt tolerance by activating the ABA signaling pathway and scavenging of reactive oxygen species. DOI: 10.1111/ppl.12651 ; PMID: 29027659
- Glutamate Receptor Homolog3.4 is Involved in Regulation of Seed Germination Under Salt Stress in Arabidopsis. DOI: 10.1093/pcp/pcy034 ; PMID: 29432559
- AtDIV2, an R-R-type MYB transcription factor of Arabidopsis, negatively regulates salt stress by modulating ABA signaling. DOI: 10.1007/s00299-018-2321-6 ; PMID: 30014159
- Pseudomonas knackmussii MLR6, a rhizospheric strain isolated from halophyte, enhances salt tolerance in Arabidopsis thaliana. DOI: 10.1111/jam.14082 ; PMID: 30142236
- SENSITIVE TO SALT1, An Endoplasmic Reticulum-Localized Chaperone, Positively Regulates Salt Resistance. DOI: 10.1104/pp.18.00840 ; PMID: 30287478
- Calcium-activated 14-3-3 proteins as a molecular switch in salt stress tolerance. DOI: 10.1038/s41467-019-09181-2 ; PMID: 30867421
- The SOS2-SCaBP8 Complex Generates and Fine-Tunes an AtANN4-Dependent Calcium Signature under Salt Stress. DOI: 10.1016/j.devcel.2019.02.010 ; PMID: 30861376
- Calcineurin B-Like Proteins CBL4 and CBL10 Mediate Two Independent Salt Tolerance Pathways in Arabidopsis. DOI: 10.3390/ijms20102421 ; PMID: 31100786
- The protein kinase complex CBL10-CIPK8-SOS1 functions in Arabidopsis to regulate salt tolerance. DOI: 10.1093/jxb/erz549 ; PMID: 31858132
- The plasma-membrane polyamine transporter PUT3 is regulated by the Na(+) /H(+) antiporter SOS1 and protein kinase SOS2. DOI: 10.1111/nph.16407 ; PMID: 31901205
- Salinity Stress-Mediated Suppression of Expression of Salt Overly Sensitive Signaling Pathway Genes Suggests Negative Regulation by AtbZIP62 Transcription Factor in Arabidopsis thaliana. DOI: 10.3390/ijms21051726 ; PMID: 32138325
- E2 conjugases UBC1 and UBC2 regulate MYB42-mediated SOS pathway in response to salt stress in Arabidopsis. DOI: 10.1111/nph.16538 ; PMID: 32167578
- 14-3-3 Proteins and Other Candidates form Protein-Protein Interactions with the Cytosolic C-terminal End of SOS1 Affecting Its Transport Activity. DOI: 10.3390/ijms21093334 ; PMID: 32397251
- ESCRT-I Component VPS23A Sustains Salt Tolerance by Strengthening the SOS Module in Arabidopsis. DOI: 10.1016/j.molp.2020.05.010 ; PMID: 32439321
- PLATZ2 negatively regulates salt tolerance in Arabidopsis seedlings by directly suppressing the expression of the CBL4/SOS3 and CBL10/SCaBP8 genes. DOI: 10.1093/jxb/eraa259 ; PMID: 32453821
- The GSK3-like Kinase BIN2 Is a Molecular Switch between the Salt Stress Response and Growth Recovery in Arabidopsis thaliana. DOI: 10.1016/j.devcel.2020.08.005 ; PMID: 32891194
- A Salt-Signaling Network Involving Ethylene, Extracellular ATP, Hydrogen Peroxide, and Calcium Mediates K(+)/Na(+) Homeostasis in Arabidopsis. DOI: 10.3390/ijms21228683 ; PMID: 33213111
- Identification and Functional Analysis of Two Purple Acid Phosphatases AtPAP17 and AtPAP26 Involved in Salt Tolerance in Arabidopsis thaliana Plant. DOI: 10.3389/fpls.2020.618716 ; PMID: 33679819
- Ethylene signaling in salt-stressed Arabidopsis thaliana ein2-1 and ctr1-1 A dissection of molecular mechanisms involved in acclimation. DOI: 10.1016/j.plaphy.2021.09.029 ; PMID: 34592706
- Distinct Roles of N-Terminal Fatty Acid Acylation of the Salinity-Sensor Protein SOS3. DOI: 10.3389/fpls.2021.691124 ; PMID: 34630451
- Interactome of Arabidopsis Thaliana. DOI: 10.3390/plants11030350 ; PMID: 35161331
- Linker histone variant HIS1-3 and WRKY1 oppositely regulate salt stress tolerance in Arabidopsis. DOI: 10.1093/plphys/kiac174 ; PMID: 35474141
- Arabidopsis Toxicos en Levadura 12 Modulates Salt Stress and ABA Responses in Arabidopsis thaliana. DOI: 10.3390/ijms23137290 ; PMID: 35806295
- Karrikin Receptor KAI2 Coordinates Salt Tolerance Mechanisms in Arabidopsis thaliana. DOI: 10.1093/pcp/pcac121 ; PMID: 35997763
- SALT OVERLY SENSITIVE 1 is inhibited by clade D Protein phosphatase 2C D6 and D7 in Arabidopsis thaliana. DOI: 10.1093/plcell/koac283 ; PMID: 36149299
- S-acylated and nucleus-localized SALT OVERLY SENSITIVE3/CALCINEURIN B-LIKE4 stabilizes GIGANTEA to regulate Arabidopsis flowering time under salt stress. DOI: 10.1093/plcell/koac289 ; PMID: 36135824
- RAP2.6 enhanced salt stress tolerance by reducing Na(+) accumulation and stabilizing the electron transport in Arabidopsis thaliana. DOI: 10.1016/j.plaphy.2023.01.003 ; PMID: 36634508
- Phosphatidic acid-regulated SOS2 controls sodium and potassium homeostasis in Arabidopsis under salt stress. DOI: 10.15252/embj.2022112401 ; PMID: 36811145
- SALT OVERLY SENSITIVE2 stabilizes phytochrome-interacting factors PIF4 and PIF5 to promote Arabidopsis shade avoidance. DOI: 10.1093/plcell/koad119 ; PMID: 37119311
- Phytochromes enhance SOS2-mediated PIF1 and PIF3 phosphorylation and degradation to promote Arabidopsis salt tolerance. DOI: 10.1093/plcell/koad117 ; PMID: 37119239
- A salt stress-activated GSO1-SOS2-SOS1 module protects the Arabidopsis root stem cell niche by enhancing sodium ion extrusion. DOI: 10.15252/embj.2022113004 ; PMID: 37211994
Gene Resources
- UniProt: M5BEH1
- EMBL: HE802944, HE802946, HE802947
- AlphaFoldDB: M5BEH1
- EnsemblPlants: AT5G35410.1
- Gramene: AT5G35410.1
- KEGG: ath:AT5G35410
- ExpressionAtlas: AT5G35410
- InterPro: IPR000719, IPR004041, IPR008271
- PANTHER: PTHR43895, PTHR43895:SF32
- SUPFAM: SSF56112
- PROSITE: PS00107, PS00108, PS50011
- Gene3D: 1.10.510.10, 3.30.310.80
- OrthoDB: M5BEH1
- SWISS-MODEL: M5BEH1
- Conserved Domain Database: cd12195
Sequences
cDNA Sequence
- >AT5G35410.1
CAATGTTAGTTTTTAAAAGTTTAATCACCCAAACGGATAATTGACCCGAACGACTAATTCAGGTCGTATACGGGTACAGTCAAATAACCCGACCCGAAATGCTCAACGGATCTGCACGGACGTTCGCATCGACGATTCACGGCTTTCGCGAATCGCATCACGAGCCTTCCTTCTCTCCTACGCCTCTTTCATCAACCCTTCTCTGCGAATCCAATTCTGATAAAAGTTTGTAAAGAATGACAAAGAAAATGAGAAGAGTGGGCAAGTACGAGGTTGGTCGCACAATAGGTGAAGGAACCTTTGCTAAGGTTAAGTTTGCGAGGAACACAGACACTGGTGATAATGTAGCCATCAAAATTATGGCTAAGAGTACAATACTTAAGAACAGAATGGTTGATCAGATAAAAAGAGAGATATCTATAATGAAGATTGTTCGTCACCCGAACATAGTGAGGTTGTATGAGGTGTTGGCGAGTCCTTCGAAAATATATATAGTTTTGGAGTTTGTGACAGGAGGAGAGCTCTTTGATAGAATTGTTCATAAAGGGAGGCTTGAAGAAAGTGAGTCTCGGAAATACTTTCAACAGCTTGTAGATGCTGTTGCTCATTGTCACTGCAAGGGTGTTTACCACCGTGACCTAAAGCCAGAAAATCTTTTACTCGATACAAATGGAAATCTGAAGGTTTCGGATTTCGGACTCAGTGCATTGCCTCAGGAAGGAGTAGAACTTCTGCGTACCACATGTGGAACTCCGAACTATGTAGCTCCAGAGGTACTTAGTGGACAGGGTTACGATGGTTCAGCAGCTGATATTTGGTCTTGCGGGGTTATTCTTTTCGTTATATTGGCTGGATATTTACCTTTTTCCGAGACGGATCTTCCAGGGTTGTACAGAAAAATAAATGCAGCAGAGTTTTCTTGTCCACCGTGGTTTTCCGCAGAAGTGAAGTTTTTAATACATAGGATACTTGACCCCAATCCCAAAACACGTATTCAAATTCAAGGAATCAAGAAAGATCCTTGGTTCAGATTAAATTATGTGCCTATACGAGCAAGGGAAGAAGAAGAAGTGAATTTGGATGATATTCGTGCAGTTTTTGATGGAATTGAGGGCAGTTATGTAGCGGAGAATGTAGAGAGAAATGATGAAGGGCCCCTGATGATGAATGCCTTTGAGATGATTACCTTATCACAAGGCTTAAATTTATCTGCACTATTTGACAGGCGACAGGATTTTGTTAAAAGGCAAACCCGTTTTGTTTCTCGAAGGGAACCTAGTGAGATAATTGCTAACATTGAGGCTGTAGCGAACTCAATGGGTTTTAAGTCTCATACACGAAACTTCAAGACAAGGCTCGAGGGATTATCTTCGATCAAGGCCGGACAGTTAGCTGTTGTGATAGAGATTTACGAGGTGGCACCATCGCTTTTCATGGTAGACGTAAGAAAGGCTGCTGGTGAAACTCTTGAATATCACAAGTTCTACAAGAAGCTATGTTCGAAACTGGAAAACATAATATGGAGGGCAACAGAAGGAATACCAAAGTCAGAGATTCTCAGAACAATCACGTTTTGATCCCAACTTAAATCCAATAAAAATGTACACTTGTGTAATAAATGACCTAATTATTCTTCAGGGAGATTGGAAGATTTGCTTCTTGAGCTAGTATTCTAATTTGATTGTGTCTTGTAGTTTGCTTTGGCCATTGGTTTGGATCCCTCTGTTCTCTGTGTATGGCAATACTTCTCAAAACTTGTCCTGCGAAGACATGTACTAACAAAACACATCCAATATGAGTTTGCTTACTAGACTACATGAGCTTTATGCCTTTATTTAGTCAAGACTATACGAGTTTAAGCTAGGCAGAGCATTTGGTTTGGATTCTTTC - >AT5G35410.2
CAATGTTAGTTTTTAAAAGTTTAATCACCCAAACGGATAATTGACCCGAACGACTAATTCAGGTCGTATACGGGTACAGTCAAATAACCCGACCCGAAATGCTCAACGGATCTGCACGGACGTTCGCATCGACGATTCACGGCTTTCGCGAATCGCATCACGAGCCTTCCTTCTCTCCTACGCCTCTTTCATCAACCCTTCTCTGCGAATCCAATTCTGATAAAAGTTTGTAAAGAATGACAAAGAAAATGAGAAGAGTGGGCAAGTACGAGGTTGGTCGCACAATAGGTGAAGGAACCTTTGCTAAGGTTAAGTTTGCGAGGAACACAGACACTGGTGATAATGTAGCCATCAAAATTATGGCTAAGAGTACAATACTTAAGAACAGAATGGTTGATCAGATAAAAAGAGAGATATCTATAATGAAGATTGTTCGTCACCCGAACATAGTGAGGTTGTATGAGGTGTTGGCGAGTCCTTCGAAAATATATATAGTTTTGGAGTTTGTGACAGGAGGAGAGCTCTTTGATAGAATTGTTCATAAAGGGAGGCTTGAAGAAAGTGAGTCTCGGAAATACTTTCAACAGCTTGTAGATGCTGTTGCTCATTGTCACTGCAAGGGTGTTTACCACCGTGACCTAAAGCCAGAAAATCTTTTACTCGATACAAATGGAAATCTGAAGGTTTCGGATTTCGGACTCAGTGCATTGCCTCAGGAAGGAGTAGAACTTCTGCGTACCACATGTGGAACTCCGAACTATGTAGCTCCAGAGGTACTTAGTGGACAGGGTTACGATGGTTCAGCAGCTGATATTTGGTCTTGCGGGGTTATTCTTTTCGTTATATTGGCTGGATATTTACCTTTTTCCGAGACGGATCTTCCAGGGTTGTACAGAAAAATAAATGCAGCAGAGTTTTCTTGTCCACCGTGGTTTTCCGCAGAAGTGAAGTTTTTAATACATAGGATACTTGACCCCAATCCCAAAACACGTATTCAAATTCAAGGAATCAAGAAAGATCCTTGGTTCAGATTAAATTATGTGCCTATACGAGCAAGGGAAGAAGAAGAAGTGAATTTGGATGATATTCGTGCAGTTTTTGATGGAATTGAGGGCAGTTATGTAGCGGAGAATGTAGAGAGAAATGATGAAGGGCCCCTGATGATGAATGCCTTTGAGATGATTACCTTATCACAAGGCTTAAATTTATCTGCACTATTTGACAGGCGACAGGATTTTGTTAAAAGGCAAACCCGTTTTGTTTCTCGAAGGGAACCTAGTGAGATAATTGCTAACATTGAGGCTGTAGCGAACTCAATGGGTTTTAAGTCTCATACACGAAACTTCAAGACAAGGCTCGAGGGATTATCTTCGATCAAGGCCGGACAGTTAGCTGTTGTGATAGAGATTTACGAGGTGGCACCATCGCTTTTCATGGTAGACGTAAGAAAGGCTGCTGGTGAAACTCTTGAATATCACAAGTTCTACAAGAAGCTATGTTCGAAACTGGAAAACATAATATGGAGGGCAACAGAAGGAATACCAAAGTCAGAGATTCTCAGAACAATCACGTTTTGATCCCAACTTAAATCCAATAAAAATGTACACTTGTGTAATAAATGACCTAATTATTCTTCAGGGAGATTGGAAGATTTGCTTCTTGAGCTAGTATTCTAATTTGATTGTGTCTTGTAGTTTGCTTTGGCCATTGGTTTGGATCCCTCTGTTCTCTGTGTATGGCAATACTTCTCAAAACTTGTCCTGCGAAGACATGTACTAACAAAACACATCCAATATGAGTTTGCTTACTAGACTACATGAGCTTTATGCCTTTATTTAGTCAAGACTATACGAGTTTAAGCTAGGCAGAGCATTTGGTTTGGATTCTTTC
CDS Sequence
Protein Sequence