Information report for AT5G34850
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009001 — fruit — frucht (exact, German), fruto (exact, Spanish), 果実 (exact, Japanese), coenocarp (narrow), syncarp (narrow), aggregate fruit (broad), compound fruit (broad), dehiscent fruit (broad), diaspore (broad), indehiscent fruit (broad), multiple fruit (broad), propagule (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- GO:0099503 — located in — secretory vesicle
- GO:0051174 — acts upstream of or within — regulation of phosphorus metabolic process
- GO:0000325 — located in — plant-type vacuole
- GO:0009536 — located in — plastid
- GO:0005773 — located in — vacuole
- GO:0003993 — enables — acid phosphatase activity
- GO:0055062 — acts upstream of or within — phosphate ion homeostasis
- GO:0005576 — located in — extracellular region
Functional Keywords
- root , fruit , root , vascular leaf , flower , stem , guard cell
Literature and News
- Purple acid phosphatases of Arabidopsis thaliana. Comparative analysis and differential regulation by phosphate deprivation. DOI: 10.1074/jbc.M204183200 ; PMID: 12021284
- Global expression profiling of sulfur-starved Arabidopsis by DNA macroarray reveals the role of O-acetyl-l-serine as a general regulator of gene expression in response to sulfur nutrition. DOI: 10.1046/j.1365-313x.2003.01658.x ; PMID: 12609039
- Transcriptome analysis of sulfur depletion in Arabidopsis thaliana: interlacing of biosynthetic pathways provides response specificity. DOI: 10.1046/j.1365-313x.2003.01657.x ; PMID: 12609038
- Large-scale identification of leaf senescence-associated genes. DOI: 10.1046/j.1365-313x.2003.01908.x ; PMID: 14617064
- Phosphatase under-producer mutants have altered phosphorus relations. DOI: 10.1104/pp.103.036459 ; PMID: 15122033
- Isolation of intact vacuoles and proteomic analysis of tonoplast from suspension-cultured cells of Arabidopsis thaliana. DOI: 10.1093/pcp/pch099 ; PMID: 15215502
- Post-genomics approaches for the elucidation of plant adaptive mechanisms to sulphur deficiency. DOI: 10.1093/jxb/erh184 ; PMID: 15208337
- Expression patterns of purple acid phosphatase genes in Arabidopsis organs and functional analysis of AtPAP23 predominantly transcribed in flower. DOI: 10.1007/s11103-005-0183-0 ; PMID: 16244908
- A reference map of the Arabidopsis thaliana mature pollen proteome. DOI: 10.1016/j.bbrc.2005.09.185 ; PMID: 16242667
- Dynamic evolution at pericentromeres. DOI: 10.1101/gr.4399206 ; PMID: 16461884
- A new picture of cell wall protein dynamics in elongating cells of Arabidopsis thaliana: confirmed actors and newcomers. DOI: 10.1186/1471-2229-8-94 ; PMID: 18796151
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Biochemical and molecular characterization of AtPAP12 and AtPAP26: the predominant purple acid phosphatase isozymes secreted by phosphate-starved Arabidopsis thaliana. DOI: 10.1111/j.1365-3040.2010.02184.x ; PMID: 20545876
- The secreted purple acid phosphatase isozymes AtPAP12 and AtPAP26 play a pivotal role in extracellular phosphate-scavenging by Arabidopsis thaliana. DOI: 10.1093/jxb/ers309 ; PMID: 23125358
- Comparative genetic analysis of Arabidopsis purple acid phosphatases AtPAP10, AtPAP12, and AtPAP26 provides new insights into their roles in plant adaptation to phosphate deprivation. DOI: 10.1111/jipb.12184 ; PMID: 24528675
- The cell wall-targeted purple acid phosphatase AtPAP25 is critical for acclimation of Arabidopsis thaliana to nutritional phosphorus deprivation. DOI: 10.1111/tpj.12663 ; PMID: 25270985
- Arabidopsis phosphatase under-producer mutants pup1 and pup3 contain mutations in the AtPAP10 and AtPAP26 genes. DOI: 10.1080/15592324.2015.1035851 ; PMID: 26251878
- A glycoform of the secreted purple acid phosphatase AtPAP26 co-purifies with a mannose-binding lectin (AtGAL1) upregulated by phosphate-starved Arabidopsis. DOI: 10.1111/pce.13432 ; PMID: 30156702
- Lectin AtGAL1 interacts with high-mannose glycoform of the purple acid phosphatase AtPAP26 secreted by phosphate-starved Arabidopsis. DOI: 10.1111/pce.13463 ; PMID: 30341950
- Identification and Functional Analysis of Two Purple Acid Phosphatases AtPAP17 and AtPAP26 Involved in Salt Tolerance in Arabidopsis thaliana Plant. DOI: 10.3389/fpls.2020.618716 ; PMID: 33679819
- The Proteome and Phosphoproteome Uncovers Candidate Proteins Associated With Vacuolar Phosphate Signal Multipled by Vacuolar Phosphate Transporter 1 (VPT1) in Arabidopsis. DOI: 10.1016/j.mcpro.2023.100549 ; PMID: 37076046
- Isolation of intact vacuoles and proteomic analysis of tonoplast from suspension-cultured cells of Arabidopsis thaliana. DOI: 10.1093/pcp/pch099 ; PMID: 15215502
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- Expression patterns of purple acid phosphatase genes in Arabidopsis organs and functional analysis of AtPAP23 predominantly transcribed in flower. DOI: 10.1007/s11103-005-0183-0 ; PMID: 16244908
- A reference map of the Arabidopsis thaliana mature pollen proteome. DOI: 10.1016/j.bbrc.2005.09.185 ; PMID: 16242667
- A sub-proteome of Arabidopsis thaliana mature stems trapped on Concanavalin A is enriched in cell wall glycoside hydrolases. DOI: 10.1093/jxb/erm082 ; PMID: 17526915
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A178UD94
- EMBL: LR881470, LUHQ01000005
- AlphaFoldDB: A0A178UD94
- EnsemblPlants: AT5G34850.1
- Gramene: AT5G34850.1
- KEGG: ath:AT5G34850
- Orthologous matrix: SSMWITW
- ExpressionAtlas: AT5G34850
- InterPro: IPR004843, IPR008963, IPR015914
- PANTHER: PTHR22953, PTHR22953:SF55
- SUPFAM: SSF49363, SSF56300
- Gene3D: 2.60.40.380, 3.60.21.10
- SWISS-MODEL: A0A178UD94
- Conserved Domain Database: cd00839
Sequences
cDNA Sequence
- >AT5G34850.1
CGTAGATGCTCTTAGAAACTTTTTCTCCAGCGATATCGTGGAAGTCTTGAGTCCAAACTTTTTCTTGACACCAAACTATTTCTAAGAATATCAAATTAGTTAAAAGGTTACGTTATGCACTTTAATGCTTAAGACCCAATCCATTTCCCTCAACCAATCATAAATCTCCACGTATGTGGTCACCTTCTTCGATAGCTCATTCATACATATCCGACGGGCTTATTAATGTCATCGAGACGATAATCTCCCAAATGTCATCTCCTTCATCTCTCAGGTAAAAAAACTGAGTCGAGATTTGGTGACGTGATGAATCATTTGGTGATAATCTCTGTGTTCTTGAGCTCAGTATTGTTGTTATATAGAGGAGAATCTGGAATCACAAGTAGTTTTATTCGATCTGAATGGCCTGCGGTTGATATACCACTTGATCATCATGTTTTCAAAGTCCCAAAAGGATATAATGCACCACAACAAGTACACATAACTCAAGGTGATTATGATGGTAAAGCTGTTATCATCTCTTGGGTTACACCTGATGAACCTGGTTCTAGCCAAGTACATTACGGTGCGGTTCAGGGGAAATATGAGTTTGTTGCTCAAGGGACTTACCATAACTACACGTTTTACAAGTATAAGTCTGGCTTTATTCATCACTGCCTTGTCTCTGACCTTGAGCATGATACAAAATACTATTACAAGATTGAAAGCGGTGAATCTTCTCGAGAGTTTTGGTTTGTTACACCACCACATGTACATCCAGATGCTTCCTACAAGTTTGGTATTATAGGCGATATGGGTCAGACATTCAACTCGTTATCCACGTTGGAACATTACATGGAGAGTGGAGCTCAGGCTGTTTTATTTCTTGGAGATCTTTCTTATGCTGATAGATATCAGTATAATGACGTTGGTGTGAGATGGGATAGCTGGGGTCGTTTTGTGGAGCGTAGTACCGCTTATCAACCGTGGCTTTGGTCTGCAGGAAATCATGAAGTAGATTACATGCCATACATGGGGGAGGTGACACCTTTCAGGAATTACCTTCAGCGTTACACTACGCCTTACTTAGCCTCAAAAAGTAGCAGTCCTCTTTGGTACGCTGTTAGGCGTGCATCTGCTCATATCATTGTCCTCTCCAGCTATTCGCCTTTTGTGAAGTATACCCCGCAATGGCACTGGCTTAGTGAAGAGCTTACAAGAGTTGATAGGGAGAAAACACCTTGGCTAATTGTTTTGATGCACGTCCCAATATACAACAGTAATGAAGCACATTTCATGGAGGGTGAAAGCATGCGAGCAGCTTTTGAGGAGTGGTTTGTCCAACACAAAGTTGATGTAATCTTTGCTGGGCATGTTCATGCCTACGAGAGATCGTACCGAATATCAAATGTGCGGTATAACGTGTCAAGCGGAGATCGTTACCCAGTTCCAGATAAGTCAGCGCCTGTTTATATCACAGTTGGAGACGGAGGAAATCAAGAAGGTCTGGCTGGAAGGTTTACGGAACCACAGCCAGATTATTCTGCATTTCGGGAAGCTAGCTATGGCCACTCTACTCTGGATATAAAGAACCGAACACACGCTATATACCACTGGAACCGCAATGATGATGGGAAGAAAGTGGCAACGGATGAATTTGTATTACACAACCAGTACTGGGGAAAGAACATTCGACGGAGAAAGCTTAAGAAGCATTATATCAGGAGTGTTGTTGGTGGCTGGATCGCCACTTAATTCACTAAGTCTGCCTCATGCTTTGTATCAAAGTGTGTGAGGATATTCTTTTAACTCGGAACTTATTACTTAATTTGATGTTAAATCTCTTTCCCGCTTAAGTTTTCAGCAATCTGGAATATGAAGGGAATTATGTATTCTTATCAGTCTTTTGATGAAGTGAGGTCTACTTCTGGGATTATGGATTTGGTGAATAATGTATTCCTTAGAACGGTGTTAAGGAATTGTTTCACATGGGTGTGAATTGAGAAGTCCATTTGTGTTTATTACATGGAGATTTGTCCAAAGAAATATAATAAAACTCTTTGCGAGGTTTCAAACATCTGATCCAGCTAAAGTGGGTCGACTAGTTCACATCGACTCTTGTATGGTTTGGGTTTGTTCAATCATATGTCGATTGTTCGCTCTTCACTTTAGTACGGGATGGGGTGTGCCTATAAGTTAGGGAAGGCTATTTGACCAGTTGCTTCGGAAGATAGAGGCTTTGTGGAATACGGATTGAACAAAATTATTACCTCTTCTCCGATACTAGCTCTCTGTACACCGATCCAGGACACTGACGATTACGAGTCAAGAGTAATGATATGCGGTTCATGTAATATCACAGTTTATGGATGAGTTGCACTTAGTACATTGGAAAGCATCATTTCATATATTTTGATACATCAATTGCTGCCTAGGTTTAGGTACCATGTTGAAAAGCTGAGTGTGTATATTGTTCTTATAGTGACTTATCTTATGCTGCATGTCCCGGTACATCACCATCTTTAAGTGTGTATGTTGTGTTTATGGCGAGTCACCCATTTTCACGAGAATGATAAGCAATAACTTATAACTGTCTCGTATTCG
CDS Sequence
Protein Sequence