Information report for AT5G30510
Gene Details
|
|
Functional Descriptions
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- GO:0044281 — acts upstream of or within — small molecule metabolic process
- GO:0009579 — located in — thylakoid
- GO:0009536 — located in — plastid
- GO:0009570 — located in — chloroplast stroma
- GO:0009416 — acts upstream of or within — response to light stimulus
- GO:0003735 — enables — structural constituent of ribosome
- GO:0003729 — enables — mRNA binding
- GO:0009507 — located in — chloroplast
- GO:0006412 — involved in — translation
Functional Keywords
- vascular leaf , flower , cotyledon , root , guard cell
Literature and News
- Identification, expression, and import of components 17 and 23 of the inner mitochondrial membrane translocase from Arabidopsis. DOI: 10.1104/pp.102.016808 ; PMID: 12692332
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Comparative analysis of bacterial-origin genes for plant mitochondrial ribosomal proteins. DOI: 10.1093/molbev/msj080 ; PMID: 16368778
- High light response of the thylakoid proteome in arabidopsis wild type and the ascorbate-deficient mutant vtc2-2. A comparative proteomics study. DOI: 10.1104/pp.106.080150 ; PMID: 16648217
- Arabidopsis displays centromeric DNA hypomethylation and cytological alterations of heterochromatin upon attack by pseudomonas syringae. DOI: 10.1094/MPMI-19-0577 ; PMID: 16776291
- Comparative gene mapping in Arabidopsis lyrata chromosomes 6 and 7 and A. thaliana chromosome IV: evolutionary history, rearrangements and local recombination rates. DOI: 10.1017/S0016672306008287 ; PMID: 17014743
- Alternative and effective proteomic analysis in Arabidopsis. DOI: 10.1002/pmic.200700346 ; PMID: 17828791
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Downregulation of chloroplast RPS1 negatively modulates nuclear heat-responsive expression of HsfA2 and its target genes in Arabidopsis. DOI: 10.1371/journal.pgen.1002669 ; PMID: 22570631
- Versatile roles of Arabidopsis plastid ribosomal proteins in plant growth and development. DOI: 10.1111/tpj.12000 ; PMID: 22900828
- A proteomics approach identifies novel proteins involved in gravitropic signal transduction. DOI: 10.3732/ajb.1200339 ; PMID: 23281391
- Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying and up-regulation. DOI: 10.1093/jxb/ert227 ; PMID: 24064926
- Comparative phospho-proteomics analysis of salt-responsive phosphoproteins regulated by the MKK9-MPK6 cascade in Arabidopsis. DOI: 10.1016/j.plantsci.2015.10.005 ; PMID: 26706066
- GUN1 Controls Accumulation of the Plastid Ribosomal Protein S1 at the Protein Level and Interacts with Proteins Involved in Plastid Protein Homeostasis. DOI: 10.1104/pp.15.02033 ; PMID: 26823545
- CHLOROPLAST RIBOSOME ASSOCIATED Supports Translation under Stress and Interacts with the Ribosomal 30S Subunit. DOI: 10.1104/pp.18.00602 ; PMID: 29914890
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- A Novel Chloroplast Protein RNA Processing 8 Is Required for the Expression of Chloroplast Genes and Chloroplast Development in Arabidopsis thaliana. DOI: 10.3389/fpls.2021.700975 ; PMID: 34956248
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- High light response of the thylakoid proteome in arabidopsis wild type and the ascorbate-deficient mutant vtc2-2. A comparative proteomics study. DOI: 10.1104/pp.106.080150 ; PMID: 16648217
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
Gene Resources
- UniProt: A0A178ULV9
- EMBL: CACRSJ010000110, CACSHJ010000095, LUHQ01000005
- AlphaFoldDB: A0A178ULV9
- EnsemblPlants: AT5G30510.1
- Gramene: AT5G30510.1
- KEGG: ath:AT5G30510
- Orthologous matrix: YDYHFSP
- ExpressionAtlas: AT5G30510
- InterPro: IPR003029, IPR012340, IPR050437
- PANTHER: PTHR10724, PTHR10724:SF7
- SUPFAM: SSF50249
- PROSITE: PS50126
- Gene3D: 2.40.50.140
- OrthoDB: A0A178ULV9
- Conserved Domain Database: cd04465, cd05692
Sequences
cDNA Sequence
- >AT5G30510.1
AACCCAACGATAAAACGCAGGAGCCATAGAAGAATAACAGATAAAACTCTCTGTGTGAGTGAGTGAGACTCAACCATGGCGTCTTTGGCTCAGCAATTCTCGGGATTGAGATGTTCCCCACTCTCTTCTTCTTCTAGGTTATCGAGGAGAGCTTCGAAGAACTTTCCCCAGAACAAATCTGCCTCTGTTTCTCCGACTATTGTCGCCGCGGTTGCAATGTCTAGCGGTCAAACAAAGGAGCGTCTTGAGCTGAAGAAGATGTTCGAAGATGCTTATGAACGATGTAGAACTTCTCCTATGGAAGGTGTTGCTTTCACCGTCGACGATTTCGCTGCTGCTATTGAACAATACGACTTCAATTCCGAAATCGGCACTAGGGTAAAAGGAACAGTGTTCAAGACTGATGCAAATGGTGCATTAGTTGACATTTCTGCAAAGTCATCGGCTTACTTGTCGGTAGAACAAGCGTGTATTCATAGAATTAAGCATGTGGAAGAAGCTGGTATTGTACCTGGTATGGTGGAAGAGTTTGTCATCATTGGTGAAAATGAAAGTGATGACAGTTTGCTATTGAGCTTAAGGAATATTCAATACGAACTTGCTTGGGAACGTTGCAGGCAGCTTCAGGCTGAGGATGTTATTGTCAAGGCTAAGGTTATTGGTGCTAACAAAGGTGGATTGGTTGCTCTTGTGGAAGGTCTTCGTGGATTTGTGCCCTTTTCGCAGATATCATCGAAAGCAGCAGCTGAAGAGCTTCTTGAAAAAGAAATACCTCTTAAGTTTGTGGAGGTTGATGAGGAACAAACAAAGCTTGTCCTCAGCAACCGTAAAGCTGTAGCAGATAGCCAAGCTCAGCTTGGAATTGGATCTGTGGTCCTCGGAGTTGTTCAGAGCTTGAAACCTTATGGTGCCTTCATTGACATTGGTGGAATCAATGGGCTTCTTCATGTCAGTCAGATAAGTCATGACCGTGTCTCAGATATCGCAACTGTTCTTCAGCCTGGTGACACTTTGAAGGTTATGATATTGAGTCACGACCGTGACAGAGGAAGAGTAAGTCTCTCCACAAAGAAGCTGGAGCCAACACCTGGTGATATGATTCGTAACCCAAAACTTGTGTTCGAGAAGGCTGAGGAGATGGCTCAGACATTCAGACAGAGAATTGCGCAAGCAGAAGCCATGGCTCGTGCAGACATGCTTCGCTTCCAACCTGAGAGTGGACTGACGCTGAGTTCTGACGGGATACTAGGACCACTCGGATCTGAGTTACCAGATGATGGCGTAGATCTAACGGTCGACGACATTCCTTCTGCAGTTGATATTTAGATTCTAAAGCTTTAGTGTATTTTTTCATACACAAAAACACCTCCTTGAGCTTAATTGAATATGTAGTTTACTTCCTACAAGACATTTTATCATGTGTACTTTGTCTTTTGTAATCGATATGTTCTGTTACAATGTCAAGAAACCAAAGAAAGGCTTTGCCCAAGACCAAACAGAGCACACGGTCTTAAAAAAAAAGATATTGTTAAATTTTTAATAAGAATTTATCCATAACCTTTACGGCAGAACAGGTGTCTTGACAAAG
CDS Sequence
Protein Sequence