Information report for AT5G28540
Gene Details
|
|
Functional Descriptions
- PO:0005020 — vascular bundle — haz vascular (Spanish, exact), vein (exact), 維管束 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- GO:0030433 — involved in — ubiquitin-dependent ERAD pathway
- GO:0000325 — located in — plant-type vacuole
- GO:0005788 — is active in — endoplasmic reticulum lumen
- GO:0099503 — located in — secretory vesicle
- GO:0005788 — located in — endoplasmic reticulum lumen
- GO:0009505 — located in — plant-type cell wall
- GO:0042026 — involved in — protein refolding
- GO:0016020 — is active in — membrane
- GO:0030433 — acts upstream of or within — ubiquitin-dependent ERAD pathway
- GO:0009408 — acts upstream of or within — response to heat
- GO:0034663 — part of — endoplasmic reticulum chaperone complex
- GO:0051085 — involved in — chaperone cofactor-dependent protein refolding
- GO:0030968 — involved in — endoplasmic reticulum unfolded protein response
- GO:0010197 — acts upstream of or within — polar nucleus fusion
- GO:0016887 — enables — ATP hydrolysis activity
- GO:0006457 — acts upstream of or within — protein folding
- GO:0009507 — located in — chloroplast
- GO:0044183 — enables — protein folding chaperone
- GO:0005634 — is active in — nucleus
- GO:0005783 — located in — endoplasmic reticulum
- GO:0031072 — enables — heat shock protein binding
- GO:0016592 — part of — mediator complex
- GO:0009506 — located in — plasmodesma
- GO:0005794 — located in — Golgi apparatus
- GO:0005737 — is active in — cytoplasm
- CS65869 — No visible phenotype.
Functional Keywords
Literature and News
- Isolation and responses to stress of a gene that encodes a luminal binding protein in Arabidopsis thaliana. DOI: 10.1093/oxfordjournals.pcp.a029023 ; PMID: 8888624
- Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. DOI: 10.1104/pp.126.2.789 ; PMID: 11402207
- Genomic analysis of the unfolded protein response in Arabidopsis shows its connection to important cellular processes. DOI: 10.1105/tpc.007609 ; PMID: 12566592
- Alternative splicing modulation by a LAMMER kinase impinges on developmental and transcriptome expression. DOI: 10.1105/tpc.011056 ; PMID: 12671088
- Expression of an evolutionarily distinct novel BiP gene during the unfolded protein response in Arabidopsis thaliana. DOI: 10.1016/s0378-1119(03)00559-6 ; PMID: 12853141
- Transcriptome analysis of O3-exposed Arabidopsis reveals that multiple signal pathways act mutually antagonistically to induce gene expression. DOI: 10.1023/B:PLAN.0000019064.55734.52 ; PMID: 15010611
- When defense pathways collide. The response of Arabidopsis to a combination of drought and heat stress. DOI: 10.1104/pp.103.033431 ; PMID: 15047901
- Proteomic analysis of the Arabidopsis cell wall reveals unexpected proteins with new cellular locations. DOI: 10.1042/BST0320524 ; PMID: 15157177
- Localization of organelle proteins by isotope tagging (LOPIT). DOI: 10.1074/mcp.T400009-MCP200 ; PMID: 15295017
- An Arabidopsis transcription factor, AtbZIP60, regulates the endoplasmic reticulum stress response in a manner unique to plants. DOI: 10.1073/pnas.0408941102 ; PMID: 15781873
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- Genome-wide identification of genes expressed in Arabidopsis pistils specifically along the path of pollen tube growth. DOI: 10.1104/pp.105.060558 ; PMID: 15894741
- Gene expression in response to endoplasmic reticulum stress in Arabidopsis thaliana. DOI: 10.1111/j.1742-4658.2005.04770.x ; PMID: 15978049
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- Proteomic analysis of different mutant genotypes of Arabidopsis led to the identification of 11 proteins correlating with adventitious root development. DOI: 10.1104/pp.105.067868 ; PMID: 16377752
- Towards the proteome of Brassica napus phloem sap. DOI: 10.1002/pmic.200500155 ; PMID: 16400686
- Proteomic analysis of differentially expressed proteins in fungal elicitor-treated Arabidopsis cell cultures. DOI: 10.1093/jxb/erj149 ; PMID: 16547123
- Purification of a plant mediator from Arabidopsis thaliana identifies PFT1 as the Med25 subunit. DOI: 10.1016/j.molcel.2007.05.007 ; PMID: 17560376
- An endoplasmic reticulum stress response in Arabidopsis is mediated by proteolytic processing and nuclear relocation of a membrane-associated transcription factor, bZIP28. DOI: 10.1105/tpc.106.050021 ; PMID: 18156219
- Identification of a novel adenine nucleotide transporter in the endoplasmic reticulum of Arabidopsis. DOI: 10.1105/tpc.107.057554 ; PMID: 18296626
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Changes in the gene expression profile of Arabidopsis thaliana after infection with Tobacco etch virus. DOI: 10.1186/1743-422X-5-92 ; PMID: 18684336
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Novel proteins, putative membrane transporters, and an integrated metabolic network are revealed by quantitative proteomic analysis of Arabidopsis cell culture peroxisomes. DOI: 10.1104/pp.108.129999 ; PMID: 18931141
- Arabidopsis bZIP60 is a proteolysis-activated transcription factor involved in the endoplasmic reticulum stress response. DOI: 10.1105/tpc.108.061002 ; PMID: 19017746
- Genomic analysis of the Hsp70 superfamily in Arabidopsis thaliana. DOI: 10.1379/1466-1268(2001)006<0201:gaoths>2.0.co;2 ; PMID: 11599561
- ER stress-induced protein, VIGG, disturbs plant cation homeostasis, which is correlated with growth retardation and robustness to ER stress. DOI: 10.1016/j.bbrc.2011.01.082 ; PMID: 21277284
- Protein disulfide isomerase-2 of Arabidopsis mediates protein folding and localizes to both the secretory pathway and nucleus, where it interacts with maternal effect embryo arrest factor. DOI: 10.1007/s10059-011-0150-3 ; PMID: 21909944
- A proteomics approach identifies novel proteins involved in gravitropic signal transduction. DOI: 10.3732/ajb.1200339 ; PMID: 23281391
- Multiple BiP genes of Arabidopsis thaliana are required for male gametogenesis and pollen competitiveness. DOI: 10.1093/pcp/pcu018 ; PMID: 24486762
- The THERMOSENSITIVE MALE STERILE 1 Interacts with the BiPs via DnaJ Domain and Stimulates Their ATPase Enzyme Activities in Arabidopsis. DOI: 10.1371/journal.pone.0132500 ; PMID: 26186593
- BiP3 supports the early stages of female gametogenesis in the absence of BiP1 and BiP2 in Arabidopsis thaliana. DOI: 10.1080/15592324.2015.1035853 ; PMID: 26251880
- SENSITIVE TO SALT1, An Endoplasmic Reticulum-Localized Chaperone, Positively Regulates Salt Resistance. DOI: 10.1104/pp.18.00840 ; PMID: 30287478
- WRKY7, -11 and -17 transcription factors are modulators of the bZIP28 branch of the unfolded protein response during PAMP-triggered immunity in Arabidopsis thaliana. DOI: 10.1016/j.plantsci.2018.09.019 ; PMID: 30466590
- The CBP/p300 histone acetyltransferases function as plant-specific MEDIATOR subunits in Arabidopsis. DOI: 10.1111/jipb.13052 ; PMID: 33325122
- Arabidopsis MHP1, a homologue of yeast Mpo1, is involved in ABA signaling. DOI: 10.1016/j.plantsci.2020.110732 ; PMID: 33568285
- Two γ-zeins induce the unfolded protein response. DOI: 10.1093/plphys/kiab367 ; PMID: 34618077
- The Arabidopsis cyclophilin CYP18-1 facilitates PRP18 dephosphorylation and the splicing of introns retained under heat stress. DOI: 10.1093/plcell/koac084 ; PMID: 35262729
- Regulation of heat shock proteins 70 and their role in plant immunity. DOI: 10.1093/jxb/erab549 ; PMID: 35022724
- Isolation and responses to stress of a gene that encodes a luminal binding protein in Arabidopsis thaliana. DOI: 10.1093/oxfordjournals.pcp.a029023 ; PMID: 8888624
- Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. DOI: 10.1104/pp.126.2.789 ; PMID: 11402207
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Proteomic analysis of different mutant genotypes of Arabidopsis led to the identification of 11 proteins correlating with adventitious root development. DOI: 10.1104/pp.105.067868 ; PMID: 16377752
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Identification of an Arabidopsis transmembrane bZIP transcription factor involved in the endoplasmic reticulum stress response. DOI: 10.1016/j.bbrc.2008.07.021 ; PMID: 18634751
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A5S9Y8G8
- EMBL: CACRSJ010000110, CACSHJ010000096
- AlphaFoldDB: A0A5S9Y8G8
- EnsemblPlants: AT5G28540.1
- Gramene: AT5G28540.1
- KEGG: ath:AT5G28540
- Orthologous matrix: GHEVEHA
- ExpressionAtlas: AT5G28540
- InterPro: IPR013126, IPR018181, IPR029047
- PANTHER: PTHR19375
- SUPFAM: SSF100920, SSF100934, SSF53067
- PROSITE: PS00297, PS00329, PS01036
- Gene3D: 1.20.1270.10, 2.60.34.10, 3.30.420.40
- OrthoDB: A0A5S9Y8G8
- SWISS-MODEL: A0A5S9Y8G8
- Conserved Domain Database: cd10241
Sequences
cDNA Sequence
- >AT5G28540.1
CCCAACAAAAGCTCATTGTCTAGAACTAAGAAGAAGAACCGAAGTAACCAACGGCCACGATTACTCCAACACAAGACCAAATCTGATTGGTTGACATTACAAATCGTCGTAAGATAATTGGTCCACGTCATCTCTGATGACATAGTTAAATTTCTTCGTCTTCCATAAAAAGCTTCTTCTTCAAAGCTTAAAAAACAAAAGGAAGCTCTCTCTGTGTTCAAAACAAGTTCATTCGATCTATAGAGACGAAACAAAAAGAGAGATCGTACGCAAAAGTTTCCGATATGGCTCGCTCGTTTGGAGCTAACAGTACCGTTGTGTTGGCGATCATCTTCTTCGGATGTTTATTTGCGTTGTCCTCTGCAATAGAAGAGGCTACGAAGTTAGGATCAGTGATAGGGATAGATCTTGGTACTACTTACTCTTGTGTTGGTGTTTACAAGAATGGTCATGTCGAAATTATTGCCAATGACCAAGGAAACCGTATTACACCTTCATGGGTTGGTTTTACTGACTCTGAAAGACTCATTGGTGAGGCTGCTAAGAATCAAGCAGCTGTTAATCCAGAGAGGACTGTCTTCGACGTTAAGAGATTGATCGGGCGAAAATTTGAGGATAAGGAGGTTCAAAAGGATAGGAAACTTGTACCTTACCAGATTGTGAACAAGGATGGTAAGCCATACATTCAAGTCAAGATCAAGGATGGTGAGACTAAGGTTTTCAGTCCTGAGGAGATTAGTGCTATGATTCTGACTAAGATGAAGGAGACAGCTGAAGCCTACCTTGGAAAGAAAATCAAGGACGCTGTTGTCACTGTTCCAGCTTACTTCAATGATGCTCAAAGGCAAGCTACTAAGGATGCTGGTGTTATTGCTGGGCTCAATGTTGCTAGAATCATTAATGAACCTACTGCTGCTGCTATTGCCTATGGTCTTGATAAGAAGGGTGGCGAGAAGAATATCCTTGTGTTTGATCTTGGTGGTGGTACTTTTGATGTCAGTGTCTTGACCATTGATAACGGAGTGTTTGAGGTTCTCTCCACAAATGGTGACACTCACTTGGGAGGTGAGGACTTTGACCACAGGGTGATGGAGTACTTCATCAAGTTGATTAAGAAGAAGCACCAGAAGGACATCAGCAAGGACAACAAGGCTCTTGGTAAGCTCCGAAGGGAATGTGAGAGGGCAAAGAGAGCTCTAAGTAGTCAGCACCAAGTCCGTGTAGAGATTGAGTCACTCTTTGATGGTGTTGATTTTTCTGAGCCACTCACCAGAGCTCGTTTCGAGGAGCTTAACAATGATTTGTTCAGGAAGACCATGGGACCTGTGAAGAAGGCCATGGATGATGCCGGTCTACAGAAGAGCCAGATCGATGAGATTGTCCTTGTTGGTGGAAGCACCAGGATCCCAAAGGTTCAGCAACTGTTGAAGGACTTCTTTGAAGGTAAAGAGCCAAACAAGGGTGTGAACCCCGACGAGGCTGTTGCCTATGGTGCTGCTGTTCAGGGTGGTATTTTGAGCGGAGAAGGCGGTGATGAGACCAAAGATATCCTTCTTCTTGATGTTGCGCCACTCACTTTGGGTATCGAGACTGTAGGAGGAGTGATGACAAAGTTGATCCCGAGAAACACGGTTATTCCAACCAAGAAATCTCAGGTTTTCACAACGTACCAAGACCAGCAGACTACCGTCTCCATTCAGGTCTTTGAAGGTGAACGAAGTCTCACCAAGGACTGCAGGCTACTCGGGAAATTCGACCTCAATGGAATCCCACCGGCCCCAAGAGGAACCCCTCAAATCGAGGTCACATTCGAAGTGGACGCCAACGGTATTCTTAATGTGAAAGCAGAGGACAAGGCGAGTGGTAAATCAGAGAAGATTACTATCACAAACGAGAAGGGTCGTCTGAGCCAAGAAGAGATTGACCGGATGGTGAAGGAGGCAGAGGAGTTTGCAGAGGAAGACAAGAAGGTAAAGGAGAAGATCGACGCCAGGAATGCCCTGGAGACATACGTGTACAACATGAAGAACCAAGTGAACGACAAGGACAAGCTTGCCGACAAATTGGAAGGAGATGAAAAGGAGAAGATCGAAGCAGCGACGAAAGAGGCTTTGGAGTGGCTCGACGAAAACCAAAACTCAGAGAAAGAAGAGTACGACGAGAAGCTCAAGGAGGTAGAGGCAGTGTGTAACCCAATCATCACAGCAGTTTACCAGAGATCTGGCGGAGCACCAGGTGGTGCAGGAGGAGAATCATCGACTGAGGAGGAAGATGAGTCTCACGATGAGCTCTAGATGTCTTTTGTTATTGTTAATTTGTTAAACCATAGAGACGAGTTTTGAGGATGAAACGTCGTTTTTTTTGTATTTGGTTTCCTTTTTATATGGATTTTTAGGAAAAGGGGAGAGATTAAGTAACGTCCCTTCTTTAGTCTCCCTGGACGTTCTCTTTATGTCTCTATGCATCAAATTACATCGATAAAGTTTTTAAAGAGTAAGTAAAGTGGGAAGGATCATAAGTCGCAAGTTACATTTTCACAATGAATTGGTGCCTCTGGGAAATTGCAGAAGAGATTAGAAAGATTGTCGACGAAAAGAGCACCAAACCTGTTAATGACGTACGCTTTGCCTGCATGATTTTAATAACGTTTATATGGGAGAAATGTGATGTTCAATTTCTATGTATAACCTCTTCTGTGCTTTTGATGCATACGGGATTACATAATTTGGAGTTTGGTGGGTTTTTTTCTTTCTTTTTTTAGAAATGTTGGGGATTTTTTTCTTTTTAATGTATGAACTCAATTGAATGTGTATAGGTCTAAATACAAATTGTCTAA
CDS Sequence
Protein Sequence