Gene Details:
- Gene ID: AT5G27770
- Gene Symbol: eL22y
- Gene Name: Ribosomal Protein eL22y
- Description: Ribosomal L22e protein family;(source:Araport11)
- TAIR Accession: locus:2180260
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0003735 — enables — structural constituent of ribosome
- GO:0022625 — located in — cytosolic large ribosomal subunit
- GO:0005737 — located in — cytoplasm
- GO:0003723 — enables — RNA binding
- GO:0002181 — involved in — cytoplasmic translation
- GO:0005730 — located in — nucleolus
- GO:0003729 — enables — mRNA binding
- GO:0009536 — located in — plastid
Function-related keywords:
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- The Arabidopsis thaliana transcriptome in response to Agrobacterium tumefaciens. DOI: 10.1094/MPMI-19-0665 ; PMID: 16776300
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night. DOI: 10.1371/journal.pone.0029307 ; PMID: 22195043
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. DOI: 10.1091/mbc.e04-09-0791 ; PMID: 15496452
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
Sequences:
cDNA Sequence
- >AT5G27770.1
AAAAAAAACCTAATAACATCTTCTTCTTCGTCTTCAAAGATCAAAAAACGCCGCTCCTCTTCACACAGTTCCATCTTCTTCAACTTCAGAGGTGAAAAATGAGTCGTGGTAACGCAGCAGCAGCTAAGGGAAAGAAGAAGGGAGTTTCCTTCACTATCGATTGTTCTAAACCTGTGGATGATAAGATTATGGAGATTGCTTCTTTAGAGAAGTTTCTTCAGGAGAGGATTAAGGTTGGTGGTAAAGCTGGTGCTCTTGGTGATTCTGTTTCTATCACTCGTGAGAAGAGCAAGATCACTGTCACTGCTGATGGTCAATTCTCCAAGAGGTATCTTAAGTACTTGACAAAGAAGTACTTGAAGAAGCACAACGTGAGGGATTGGCTTAGAGTGATTGCGGCGAACAAGGACCGTAACCTCTATGAGTTGAGGTACTTCAACATTGCCGAGAACGAAGCTGAGGAAGAAGATTAAAACCGGTTTTGGTCTAGTGCTATATCCTCTGTTCCTCTATTTCTGTTGGTTTGGTTTTGATTCTTCAGTTTTGTGTTAGATATTATTATGTAGTTTGATTGAAGTAATACTCTTTGCTTTTGTTGTTGCGTACTTGAGATTTTCTATGGAGTCTATTTCTTCCAAACAGTAATGATGTGAAATTGGACTAATATGATTTAGGGTTTGATTAAGTTATTCATTGGAGGATAAAATTATGACAAATTCGTATAGTTAACTTTGGGTTTGGTTATTGTTTTTGTCCAATACAGTATTTGGATTATCACTCGCGTTAGA
CDS Sequence
Protein Sequence