Gene Details:
- Gene ID: AT5G27200
- Gene Symbol: ACP5, AtACP5
- Gene Name: acyl carrier protein 5
- Description: acyl carrier protein 5;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Function-related keywords:
Literature:
- Differential regulation of mRNA levels of acyl carrier protein isoforms in Arabidopsis. DOI: 7044 ; PMID: 11788768
- Expression of constitutive and tissue-specific acyl carrier protein isoforms in Arabidopsis. DOI: 10.1104/pp.98.1.206 ; PMID: 16668615
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Integrative analysis of transcript and metabolite profiling data sets to evaluate the regulation of biochemical pathways during photomorphogenesis. DOI: 10.1016/j.abb.2005.11.020 ; PMID: 16460663
- Proteomic and transcriptomic analysis of Arabidopsis seeds: molecular evidence for successive processing of seed proteins and its implication in the stress response to sulfur nutrition. DOI: 10.1111/j.1365-313X.2006.02900.x ; PMID: 17059406
- LEAFY COTYLEDON1 is a key regulator of fatty acid biosynthesis in Arabidopsis. DOI: 10.1104/pp.108.126342 ; PMID: 18689444
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Acyl-lipid metabolism. DOI: 10.1199/tab.0161 ; PMID: 23505340
- Genes of ACYL CARRIER PROTEIN Family Show Different Expression Profiles and Overexpression of ACYL CARRIER PROTEIN 5 Modulates Fatty Acid Composition and Enhances Salt Stress Tolerance in Arabidopsis. DOI: 10.3389/fpls.2017.00987 ; PMID: 28642782
- ATL8, a RING E3 ligase, modulates root growth and phosphate homeostasis in Arabidopsis. DOI: 10.1016/j.plaphy.2022.03.019 ; PMID: 35325659
Sequences:
cDNA Sequence
- >AT5G27200.1
ATGGCGACAAGTTTCTGCTCCTCCATCTCCATGCAAGCTCCTTTCTCGGCTACAACAACAAGGTTCTGTCTCAACAAACAGGCTACGATTTTCAACAATGAAAAGACTAATAATCTCTCCTTCAGCCTACGACGTTTGATGCCTGCTCGTCTCGCAGTTTCTTGTGCAGTCAAGCAAGAGACAGTAGAGAAAGTGTCTGAGATTGTCAAGAAGCAATTGTCGCTCACCGATGATCAAAAAGTCACTGCCGGAACTAAATTTACCGAGCTTGGAGCTGATTCTCTCGACACGGTTGAGATAGTGATGGGTTTGGAGGAAGAGTTCGGGATAACAATGGCGGAAGAGAGAGCAAAGGAGATTGCAACAGTCCAACAGGCTGCTGAACTCATTGAAGAACTCGTCCAAGAGAAGACTGCTTAGTTAAGGAAACAACCAAAGGCTTTTGTCTTTTGTTATTGCCGTTTGCTCAATTGTGTCATGCTTTGTTGTATGTCTTAATTTGCCCTAGTGGTTTATTATGTCAATCTTTAGACTACTACAAAACTTTCTTTTAGATTATCAGCTTAAGGAACAAAGAGATTCACAAGACATTTTGGATTTATAAAAGAGAAAGAAACATGAGGAAAAAGTACAGACATACAAAA
CDS Sequence
Protein Sequence