Information report for AT5G27150
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- nhx1 — Reduced monovalent cation-dependent proton transport activity. Vacuoles isolated from leaves had a much lower Na+/H+ exchange activity. Altered leaf development, with a reduction in the frequency of large epidermal cells and a reduction in overally leaf area compared to wt plants.
Functional Keywords
Literature and News
- The Arabidopsis thaliana proton transporters, AtNhx1 and Avp1, can function in cation detoxification in yeast. DOI: 10.1073/pnas.96.4.1480 ; PMID: 9990049
- Na+/H+ antiporter from Synechocystis species PCC 6803, homologous to SOS1, contains an aspartic residue and long C-terminal tail important for the carrier activity. DOI: 10.1104/pp.125.1.437 ; PMID: 11154351
- Halotolerant cyanobacterium Aphanothece halophytica contains an Na(+)/H(+) antiporter, homologous to eukaryotic ones, with novel ion specificity affected by C-terminal tail. DOI: 10.1074/jbc.M103650200 ; PMID: 11479290
- Phylogenetic relationships within cation transporter families of Arabidopsis. DOI: 10.1104/pp.126.4.1646 ; PMID: 11500563
- Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. DOI: 10.1046/j.1365-313x.2002.01309.x ; PMID: 12047628
- Regulation of expression of the vacuolar Na+/H+ antiporter gene AtNHX1 by salt stress and abscisic acid. DOI: 10.1023/a:1019859319617 ; PMID: 12369629
- Regulation of vacuolar Na+/H+ exchange in Arabidopsis thaliana by the salt-overly-sensitive (SOS) pathway. DOI: 10.1074/jbc.M307982200 ; PMID: 14570921
- DNA array analyses of Arabidopsis thaliana lacking a vacuolar Na+/H+ antiporter: impact of AtNHX1 on gene expression. DOI: 10.1111/j.1365-313X.2004.02253.x ; PMID: 15546358
- Cloning and characterization of a wheat vacuolar cation/proton antiporter and pyrophosphatase proton pump. DOI: 10.1016/j.plaphy.2005.02.010 ; PMID: 15907686
- Vacuolar Na+/H+ antiporter cation selectivity is regulated by calmodulin from and pH-dependent manner. DOI: 10.1073/pnas.0504437102 ; PMID: 16249341
- Alkali cation exchangers: roles in cellular homeostasis and stress tolerance. DOI: 10.1093/jxb/erj114 ; PMID: 16513813
- Arabidopsis-rice-wheat gene orthologues for Na+ transport and transcript analysis in wheat-L. elongatum aneuploids under salt stress. DOI: 10.1007/s00438-006-0184-y ; PMID: 17103227
- AtNHX8, a member of the monovalent cation: proton antiporter-1 family in Arabidopsis thaliana, encodes a putative Li/H antiporter. DOI: 10.1111/j.1365-313X.2006.02990.x ; PMID: 17270011
- Impact of AtNHX1, a vacuolar Na+/H+ antiporter, upon gene expression during and long-term salt stress in Arabidopsis thaliana. DOI: 10.1186/1471-2229-7-18 ; PMID: 17411438
- Enhanced salt tolerance of transgenic progeny of tall fescue (Festuca arundinacea) expressing a vacuolar Na+/H+ antiporter gene from Arabidopsis. DOI: 10.1016/j.jplph.2007.04.001 ; PMID: 17561307
- Salt tolerance conferred by overexpression of Arabidopsis vacuolar Na(+)/H (+) antiporter gene AtNHX1 in common buckwheat (Fagopyrum esculentum). DOI: 10.1007/s11248-007-9085-z ; PMID: 17541720
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Overexpression of SOS (Salt Overly Sensitive) genes increases salt tolerance in transgenic Arabidopsis. DOI: 10.1093/mp/ssn058 ; PMID: 19529826
- HKT transporter-mediated salinity resistance mechanisms in Arabidopsis and monocot crop plants. DOI: 10.1016/j.tplants.2009.08.009 ; PMID: 19783197
- Comparative effect of potassium on K and Na uptake and transport in two accessions of Arabidopsis thaliana during salinity stress. DOI: 10.1016/j.crvi.2009.05.003 ; PMID: 19748453
- Regulation by salt of vacuolar H+-ATPase and H+-pyrophosphatase activities and Na+/H+ exchange. DOI: 10.4161/psb.4.8.9236 ; PMID: 19820346
- Overexpression of soybean ubiquitin-conjugating enzyme gene GmUBC2 confers enhanced drought and salt tolerance through modulating abiotic stress-responsive gene expression in Arabidopsis. DOI: 10.1007/s11103-009-9575-x ; PMID: 19941154
- Dynamic aspects of ion accumulation by vesicle traffic under salt stress in Arabidopsis. DOI: 10.1093/pcp/pcp143 ; PMID: 19880402
- Variation in salinity tolerance and shoot sodium accumulation in Arabidopsis ecotypes linked to differences in the natural expression levels of transporters involved in sodium transport. DOI: 10.1111/j.1365-3040.2009.02105.x ; PMID: 20040066
- A novel plant vacuolar Na+/H+ antiporter gene evolved by DNA shuffling confers improved salt tolerance in yeast. DOI: 10.1074/jbc.M109.073783 ; PMID: 20457597
- Comparative genomic analysis of 1047 completely sequenced cDNAs from an Arabidopsis-related model halophyte, Thellungiella halophila. DOI: 10.1186/1471-2229-10-261 ; PMID: 21106055
- Assessing the role of root plasma membrane and tonoplast Na+/H+ exchangers in salinity tolerance in wheat: in planta quantification methods. DOI: 10.1111/j.1365-3040.2011.02296.x ; PMID: 21342209
- The Arabidopsis Na+/H+ antiporters NHX1 and NHX2 control vacuolar pH and K+ homeostasis to regulate growth, flower development, and reproduction. DOI: 10.1105/tpc.111.089581 ; PMID: 21954467
- Arabidopsis NRT1.5 is another essential component in the regulation of nitrate reallocation and stress tolerance. DOI: 10.1104/pp.112.199257 ; PMID: 22685171
- A stress inducible SUMO conjugating enzyme gene (SaSce9) from a grass halophyte Spartina alterniflora enhances salinity and drought stress tolerance in Arabidopsis. DOI: 10.1186/1471-2229-12-187 ; PMID: 23051937
- Physiological and molecular mechanisms of plant salt tolerance. DOI: 10.1007/s11120-013-9813-6 ; PMID: 23539361
- A Medicago truncatula EF-hand family gene, MtCaMP1, is involved in drought and salt stress tolerance. DOI: 10.1371/journal.pone.0058952 ; PMID: 23593126
- SKIP Confers Osmotic Tolerance during Salt Stress by Controlling Alternative Gene Splicing in Arabidopsis. DOI: 10.1016/j.molp.2015.01.011 ; PMID: 25617718
- Chrysanthemum WRKY gene CmWRKY17 negatively regulates salt stress tolerance in transgenic chrysanthemum and Arabidopsis plants. DOI: 10.1007/s00299-015-1793-x ; PMID: 25893877
- Heterologous expression of the halophyte Zoysia matrella H⁺-pyrophosphatase gene improved salt tolerance in Arabidopsis thaliana. DOI: 10.1016/j.plaphy.2015.04.004 ; PMID: 25874657
- Potassium Retention under Salt Stress Is Associated with Natural Variation in Salinity Tolerance among Arabidopsis Accessions. DOI: 10.1371/journal.pone.0124032 ; PMID: 25993093
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Co-overexpressing a Plasma Membrane and a Vacuolar Membrane Sodium/Proton Antiporter Significantly Improves Salt Tolerance in Transgenic Arabidopsis Plants. DOI: 10.1093/pcp/pcw055 ; PMID: 26985021
- Cold stress increases salt tolerance of the extremophytes Eutrema salsugineum (Thellungiella salsuginea) and Eutrema (Thellungiella) botschantzevii. DOI: 10.1016/j.jplph.2016.10.009 ; PMID: 27940414
- Beneficial Rhizobacterium Bacillus amyloliquefaciens SQR9 Induces Plant Salt Tolerance through Spermidine Production. DOI: 10.1094/MPMI-02-17-0027-R ; PMID: 28291380
- Salt stress-induced FERROCHELATASE 1 improves resistance to salt stress by limiting sodium accumulation in Arabidopsis thaliana. DOI: 10.1038/s41598-017-13593-9 ; PMID: 29116128
- Pseudomonas knackmussii MLR6, a rhizospheric strain isolated from halophyte, enhances salt tolerance in Arabidopsis thaliana. DOI: 10.1111/jam.14082 ; PMID: 30142236
- Full-length transcriptome sequences of ephemeral plant Arabidopsis pumila provides insight into gene expression dynamics during continuous salt stress. DOI: 10.1186/s12864-018-5106-y ; PMID: 30261913
- K(+) Efflux Antiporters 4, 5, and 6 Mediate pH and K(+) Homeostasis in Endomembrane Compartments. DOI: 10.1104/pp.18.01053 ; PMID: 30309966
- The Effect of AtHKT1;1 or AtSOS1 Mutation on the Expressions of Na⁺ or K⁺ Transporter Genes and Ion Homeostasis in Arabidopsis thaliana under Salt Stress. DOI: 10.3390/ijms20051085 ; PMID: 30832374
- CALMODULIN-BINDING TRANSCRIPTION ACTIVATOR 6: A Key Regulator of Na(+) Homeostasis during Germination. DOI: 10.1104/pp.19.00119 ; PMID: 30894419
- PLATZ2 negatively regulates salt tolerance in Arabidopsis seedlings by directly suppressing the expression of the CBL4/SOS3 and CBL10/SCaBP8 genes. DOI: 10.1093/jxb/eraa259 ; PMID: 32453821
- Auxin Homeostasis and Distribution of the Auxin Efflux Carrier PIN2 Require Vacuolar NHX-Type Cation/H(+) Antiporter Activity. DOI: 10.3390/plants9101311 ; PMID: 33023035
- Induction of Salt Tolerance in Arabidopsis thaliana by Volatiles From Bacillus amyloliquefaciens FZB42 via the Jasmonic Acid Signaling Pathway. DOI: 10.3389/fmicb.2020.562934 ; PMID: 33281760
- Identification and Functional Analysis of Two Purple Acid Phosphatases AtPAP17 and AtPAP26 Involved in Salt Tolerance in Arabidopsis thaliana Plant. DOI: 10.3389/fpls.2020.618716 ; PMID: 33679819
- The Endophytic Strain ZS-3 Enhances Salt Tolerance in Arabidopsis thaliana by Regulating Photosynthesis, Osmotic Stress, and Ion Homeostasis and Inducing Systemic Tolerance. DOI: 10.3389/fpls.2022.820837 ; PMID: 35386673
- Heterologous expression of a Fraxinus velutina SnRK2 gene in Arabidopsis increases salt tolerance by modifying root development and ion homeostasis. DOI: 10.1007/s00299-022-02899-2 ; PMID: 35794394
- Karrikin Receptor KAI2 Coordinates Salt Tolerance Mechanisms in Arabidopsis thaliana. DOI: 10.1093/pcp/pcac121 ; PMID: 35997763
- RAP2.6 enhanced salt stress tolerance by reducing Na(+) accumulation and stabilizing the electron transport in Arabidopsis thaliana. DOI: 10.1016/j.plaphy.2023.01.003 ; PMID: 36634508
- Phylogenetic relationships within cation transporter families of Arabidopsis. DOI: 10.1104/pp.126.4.1646 ; PMID: 11500563
- Large-scale analysis of in vivo phosphorylated membrane proteins by immobilized metal ion affinity chromatography and mass spectrometry. DOI: 10.1074/mcp.T300006-MCP200 ; PMID: 14506206
Gene Resources
- UniProt: Q0WVZ5
- EMBL: AK226586, HE802878, HE802879
- AlphaFoldDB: Q0WVZ5
- EnsemblPlants: AT5G27150.1
- Gramene: AT5G27150.1
- KEGG: ath:AT5G27150
- Orthologous matrix: APSHKVH
- ExpressionAtlas: AT5G27150
- InterPro: IPR004709, IPR006153, IPR018422
- PANTHER: PTHR10110, PTHR10110:SF163
- Gene3D: 6.10.140.1330
- OrthoDB: Q0WVZ5
- SWISS-MODEL: Q0WVZ5
Sequences
cDNA Sequence
- >AT5G27150.1
CCACAATAAATCCAAACACTAAACTGTTCAGATCTCAGATAGTAACTTTAAATCAACGGCTATAAATTCGCCATTTGTACTTTCATTTACACAACAGAGAATAATACATACACTCTATCTCTCTCCTATTCGTAACTTATATTTCTCTCTCTACTGTGTTTAGAAATTGGAATCTTCTCTCTTCTCTATCTCCCTCTCTCTTAAAAAGGGACCGTACACGTCTCTCTCTATTTCCAGTAAAAAATCGAAATTTCGTATAATTTCCTCAGTCCCGTAATTTTCTCCTTTTTTTTCTTCCCCAATTCCTTCAATTTTCGAATTCGCCTCTCTGTTTCGTTCCTCGTAGACGAAGAAGAAGAAGAATCTCAGGTTTTAGCTTTCGAAGCTTCCAAAATTTTGAATTTTGATCTTCTGGGCTCTTTTGTAAATCAGACTGAAGATATTTAGATTACCCAGAAGTTGTTCAAGGAATGGTTTCAGTGGACAGCACGGAAAGATAAAAGAGACTTTTTTTTCCAGATTTTGCTGATCCAAAATCTGAATAGTTGTTCATGTTCTTGGATCAAATCTGGAAAGAGGAAGTTTGTTGGATCTAGAAGAAGATAACAATGTTGGATTCTCTAGTGTCGAAACTGCCTTCGTTATCGACATCTGATCACGCTTCTGTGGTTGCGTTGAATCTCTTTGTTGCACTTCTTTGTGCTTGTATTGTTCTTGGTCATCTTTTGGAAGAGAATAGATGGATGAACGAATCCATCACCGCCTTGTTGATTGGGCTAGGCACTGGTGTTACCATTTTGTTGATTAGTAAAGGAAAAAGCTCGCATCTTCTCGTCTTTAGTGAAGATCTTTTCTTCATATATCTTTTGCCACCCATTATATTCAATGCAGGGTTTCAAGTAAAAAAGAAGCAGTTTTTCCGCAATTTCGTGACTATTATGCTTTTTGGTGCTGTTGGGACTATTATTTCTTGCACAATCATATCTCTAGGTGTAACACAGTTCTTTAAGAAGTTGGACATTGGAACCTTTGACTTGGGTGATTATCTTGCTATTGGTGCCATATTTGCTGCAACAGATTCAGTATGTACACTGCAGGTTCTGAATCAAGACGAGACACCTTTGCTTTACAGTCTTGTATTCGGAGAGGGTGTTGTGAATGATGCAACGTCAGTTGTGGTCTTCAACGCGATTCAGAGCTTTGATCTCACTCACCTAAACCACGAAGCTGCTTTTCATCTTCTTGGAAACTTCTTGTATTTGTTTCTCCTAAGTACCTTGCTTGGTGCTGCAACCGGTCTGATAAGTGCGTATGTTATCAAGAAGCTATACTTTGGAAGGCACTCAACTGACCGAGAGGTTGCCCTTATGATGCTTATGGCGTATCTTTCTTATATGCTTGCTGAGCTTTTCGACTTGAGCGGTATCCTCACTGTGTTTTTCTGTGGTATTGTGATGTCCCATTACACATGGCACAATGTAACGGAGAGCTCAAGAATAACAACAAAGCATACCTTTGCAACTTTGTCATTTCTTGCGGAGACATTTATTTTCTTGTATGTTGGAATGGATGCCTTGGACATTGACAAGTGGAGATCCGTGAGTGACACACCGGGAACATCGATCGCAGTGAGCTCAATCCTAATGGGTCTGGTCATGGTTGGAAGAGCAGCGTTCGTCTTTCCGTTATCGTTTCTATCTAACTTAGCCAAGAAGAATCAAAGCGAGAAAATCAACTTTAACATGCAGGTTGTGATTTGGTGGTCTGGTCTCATGAGAGGTGCTGTATCTATGGCTCTTGCATACAACAAGTTTACAAGGGCCGGGCACACAGATGTACGCGGGAATGCAATCATGATCACGAGTACGATAACTGTCTGTCTTTTTAGCACAGTGGTGTTTGGTATGCTGACCAAACCACTCATAAGCTACCTATTACCGCACCAGAACGCCACCACGAGCATGTTATCTGATGACAACACCCCAAAATCCATACATATCCCTTTGTTGGACCAAGACTCGTTCATTGAGCCTTCAGGGAACCACAATGTGCCTCGGCCTGACAGTATACGTGGCTTCTTGACACGGCCCACTCGAACCGTGCATTACTACTGGAGACAATTTGATGACTCCTTCATGCGACCCGTCTTTGGAGGTCGTGGCTTTGTACCCTTTGTTCCAGGTTCTCCAACTGAGAGAAACCCTCCTGATCTTAGTAAGGCTTGAGGGTAACGTGGAAGAAAAGCTTTGATTTTTTTTGGTAGAAAAGGGTGATTCAAATTATGCTTTTGTGTAAATTATCCATTTGTAATATTGTTTGTGAGGACAGAAATCTGTCCTAACGTTTTGAGAGCAGAAAGCAAAACATGGCAACTTTGAAGTGTTTGATTGATGTATGTAATTATATTCATATTTGTTTTGTTGTAACACAAACTACACATTTGTTTATGTTTTGAATTTGGTTTTTGCTTCGAACTTGAGGATCGGATTGGTACGGTTTGGTTCGATTTCGGACAAAAATATTAATAAAGAATTATTTCTTTATGTCAAAACA
CDS Sequence
Protein Sequence