Gene Details:
- Gene ID: AT5G26930
- Gene Symbol: GATA23
- Gene Name: GATA transcription factor 23
- Description: GATA transcription factor 23;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Function-related keywords:
Literature:
- Interaction of a GATA factor with cis-acting elements involved in light regulation of nuclear genes encoding chloroplast glyceraldehyde-3-phosphate dehydrogenase in Arabidopsis. DOI: 10.1016/s0006-291x(02)02892-9 ; PMID: 12504119
- The GATA family of transcription factors in Arabidopsis and rice. DOI: 10.1104/pp.103.037788 ; PMID: 15084732
- Genetic analysis of Arabidopsis GATA transcription factor gene family reveals a nitrate-inducible member important for chlorophyll synthesis and glucose sensitivity. DOI: 10.1111/j.1365-313X.2005.02568.x ; PMID: 16262716
- Expression profiling and mutant analysis reveals complex regulatory networks involved in Arabidopsis response to Botrytis infection. DOI: 10.1111/j.1365-313X.2006.02849.x ; PMID: 16925600
- Conservation, convergence, and divergence of light-responsive, circadian-regulated, and tissue-specific expression patterns during evolution of the Arabidopsis GATA gene family. DOI: 10.1104/pp.106.090761 ; PMID: 17208962
- SWP1 negatively regulates lateral root initiation and elongation in Arabidopsis. DOI: 10.4161/psb.22099 ; PMID: 23073020
- Functional diversification within the family of B-GATA transcription factors through the leucine-leucine-methionine domain. DOI: 10.1104/pp.114.246660 ; PMID: 25077795
- Establishment of Expression in the SHORTROOT-SCARECROW Transcriptional Cascade through Opposing Activities of Both Activators and Repressors. DOI: 10.1016/j.devcel.2016.09.031 ; PMID: 27923776
- Root-knot nematodes induce gall formation by recruiting developmental pathways of post-embryonic organogenesis and regeneration to promote transient pluripotency. DOI: 10.1111/nph.16521 ; PMID: 32129890
- Divergent regulation of auxin responsive genes in root-knot and cyst nematodes feeding sites formed in Arabidopsis. DOI: 10.3389/fpls.2023.1024815 ; PMID: 36875577
Sequences:
cDNA Sequence
- >AT5G26930.1
GAGAGGGTTTTTAAGGAGCTCTTAAGCCTTTCTTGATGACTCATACCACGAACAAGAACCAATCTTGTCACCCATATAATCTCCGTATTCAGAGAATTGAAGAGTTCTTGATCACTACTGTTGTATCAAAAAGGAACTCTAAGAACTAAGATTGTTTTTTTTTATTTGATGGATCCAAGGAAGCTACTATCTTGTTCATCCTCTTACGTGTCAGTGAGAATGAAAGAAGAGAAGGGGACAATTAGGTGTTGCAGTGAGTGTAAGACCACCAAGACACCAATGTGGAGAGGTGGACCAACTGGTCCTAAGTCACTTTGCAATGCATGTGGAATTAGACACAGAAAACAGAGACGATCAGAGTTATTGGGTATTCATATTATTCGCAGCCACAAAAGCTTAGCCTCCAAGAAGATAAACCTATTATCATCATCACACGGTGGCGTGGCGGTGAAGAAACGAAGGAGTCTAAAGGAGGAAGAACAAGCTGCTTTGTGTCTATTGTTATTGTCTTGTAGCTCTGTTTTGGCCTAAGTCAAAAAACAGAATATCTCTCGCTAGAAAGTTAAAAAAACACAGTTTTGTCCTCTCCTTTGTTGACGTTCTATATCTATTTTGGGTCACTCTTTTGAATATGAATAATTTAAGATTTAATGAAATAAGTTGGGCCTAA
CDS Sequence
Protein Sequence