Gene Details:

  • Gene ID: AT5G26594
  • Gene Symbol: ARR24, RR24
  • Gene Name: response regulator 24, response regulator 24
  • Description: response regulator 24;(source:Araport11)
  • TAIR Accession: locus:1005716875
  • Genome: Araport11_genome_release
  • Species: Arabidopsis thaliana

Transcripts:

Plant Ontology Annotations:

  • PO:0000056  — flower bud — floral bud (exact), yema floral (Spanish, exact), 花芽 (Japanese, exact)
  • PO:0009001  — fruit — frucht (exact, German), fruto (exact, Spanish), 果実 (exact, Japanese), coenocarp (narrow), syncarp (narrow), aggregate fruit (broad), compound fruit (broad), dehiscent fruit (broad), diaspore (broad), indehiscent fruit (broad), multiple fruit (broad), propagule (broad)
  • PO:0009046  — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
  • PO:0025281  — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)

Gene Ontology:

  • GO:0009507  — located in — chloroplast
  • GO:0008150  — involved in — biological_process
  • GO:0003674  — enables — molecular_function

Germplasm Phenotype:

  • ARR22 KO ARR24 KO  — There are no consistently detectable phenotypic differences between this double mutant and wild-type plants grown under normal conditions.
  • SALK_124785C  — There are no detectable phenotypic differences between this mutant and wild-type plants grown under normal conditions.

Literature:

Sequences:

cDNA Sequence
  • >AT5G26594.1
    ATGACGAGAGATCAAGTAGCTGAAGAACTTCCAAATTTGGCAGAGTCGAAGTTAACAGCTTTGGTCGTCGATGACAGTTTCGTAAACCAAACTATACATCAGAAGCTGTTGAATCGTCTAGGGATTAAAAACGACGTCGTCACAAACGGAAAAGAAGCCGTCGACGTTTATTGTTCCGGCGGTAACTATGATCTTATTCTTATGGACATGGACATGCCCATCATGAACGGTATTCAGGCAACAAAGAGACTAAGGGAGATGGGAATAGAGAGCAAGATAGCAGGAGTAACAACACGAGCTAACGAAGGAGAGAAGAAAGAGTTTATGGAAGCTGGCCTTAATGATTTTCAAGAGAAACCTCTTACCATCTCTAAGCTTCTCTCTATTCTTCATAAACTTAATTTCTACGTCCAAACCTAA
CDS Sequence
Protein Sequence