Information report for AT5G26000
Gene Details
|
|
Functional Descriptions
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- PO:0005417 — phloem — floema (Spanish, exact), portion of phloem tissue (exact), 師部、師管 (Japanese, exact)
- GO:0019762 — acts upstream of or within — glucosinolate catabolic process
- GO:0009507 — located in — chloroplast
- GO:0009737 — involved in — response to abscisic acid
- GO:0022626 — located in — cytosolic ribosome
- GO:0005777 — located in — peroxisome
- GO:0009625 — acts upstream of or within — response to insect
- GO:0009579 — located in — thylakoid
- GO:0005975 — involved in — carbohydrate metabolic process
- GO:0000325 — located in — plant-type vacuole
- GO:0019137 — enables — thioglucosidase activity
- GO:0009536 — located in — plastid
- GO:0005576 — located in — extracellular region
- GO:0002213 — involved in — defense response to insect
- GO:0102799 — enables — glucosinolate glucohydrolase activity
- GO:0008422 — enables — beta-glucosidase activity
- GO:0048046 — located in — apoplast
- GO:0099503 — located in — secretory vesicle
- GO:0102483 — enables — scopolin beta-glucosidase activity
- CS6565 — 95% reduction in myrosinase activity in above-ground tissue; no visible phenotype.
- CS6566 — 95% reduction in myrosinase activity in above-ground tissue; no visible phenotype.
- CS72341 — very low myrosinase activity in leaf tissue; reduced resistance to feeding by generalist insect herbivores
- CS72545 — very low myrosinase activity in leaf tissue; reduced resistance to feeding by generalist insect herbivores
- SAIL_786_B08 — contains only 5% of wild-type myrosinase activity, in the above-ground tissues
- tgg1-3 tgg2-1 — contains only 1% of wild-type myrosinase activity. Among the above-ground tissues, the activity is only detected in flowers.
Functional Keywords
Literature and News
- COI1 affects myrosinase activity and controls the expression of two flower-specific myrosinase-binding protein homologues in Arabidopsis. DOI: 10.1007/s004250100548 ; PMID: 11678272
- Heating decreases epithiospecifier protein activity and increases sulforaphane formation in broccoli. DOI: 10.1016/j.phytochem.2004.04.013 ; PMID: 15184012
- Characterisation of recombinant epithiospecifier protein and its over-expression in Arabidopsis thaliana. DOI: 10.1016/j.phytochem.2005.02.026 ; PMID: 15845404
- Arabidopsis myrosinases TGG1 and TGG2 have redundant function in glucosinolate breakdown and insect defense. DOI: 10.1111/j.1365-313X.2006.02716.x ; PMID: 16640593
- Myzus persicae (green peach aphid) feeding on Arabidopsis induces the formation of a deterrent indole glucosinolate. DOI: 10.1111/j.1365-313X.2006.03019.x ; PMID: 17257166
- Proteome analysis of Arabidopsis leaf peroxisomes reveals novel targeting peptides, metabolic pathways, and defense mechanisms. DOI: 10.1105/tpc.107.050989 ; PMID: 17951448
- Identification of indole glucosinolate breakdown products with antifeedant effects on Myzus persicae (green peach aphid). DOI: 10.1111/j.1365-313X.2008.03476.x ; PMID: 18346197
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Functional genomic analysis of Arabidopsis thaliana glycoside hydrolase family 1. DOI: 10.1007/s11103-004-0790-1 ; PMID: 15604686
- Myrosinases from root and leaves of Arabidopsis thaliana have different catalytic properties. DOI: 10.1016/j.phytochem.2009.07.036 ; PMID: 19703694
- MODIFIED VACUOLE PHENOTYPE1 is an Arabidopsis myrosinase-associated protein involved in endomembrane protein trafficking. DOI: 10.1104/pp.109.145078 ; PMID: 19880612
- Identification of lipids and lipid-binding proteins in phloem exudates from Arabidopsis thaliana. DOI: 10.1093/jxb/ers028 ; PMID: 22442409
- A proteomic analysis of Arabidopsis thaliana seedling responses to 3-oxo-octanoyl-homoserine lactone, a bacterial quorum-sensing signal. DOI: 10.1016/j.bbrc.2012.09.044 ; PMID: 22995300
- Water stress and aphid feeding differentially influence metabolite composition in Arabidopsis thaliana (L.). DOI: 10.1371/journal.pone.0048661 ; PMID: 23144921
- Interaction of glucosinolate content of Arabidopsis thaliana mutant lines and feeding and oviposition by generalist and specialist lepidopterans. DOI: 10.1016/j.phytochem.2012.11.006 ; PMID: 23218016
- FAMA is an essential component for the differentiation of two distinct cell types, myrosin cells and guard cells, in Arabidopsis. DOI: 10.1105/tpc.114.129874 ; PMID: 25304202
- Myrosin idioblast cell fate and development are regulated by the Arabidopsis transcription factor FAMA, the auxin pathway, and vesicular trafficking. DOI: 10.1105/tpc.114.129726 ; PMID: 25304201
- Classic myrosinase-dependent degradation of indole glucosinolate attenuates fumonisin B1-induced programmed cell death in Arabidopsis. DOI: 10.1111/tpj.12778 ; PMID: 25645692
- Identifying the ionically bound cell wall and intracellular glycoside hydrolases in late growth stage Arabidopsis stems: implications for the genetic engineering of bioenergy crops. DOI: 10.3389/fpls.2015.00315 ; PMID: 26029221
- Nictaba Homologs from Arabidopsis thaliana Are Involved in Plant Stress Responses. DOI: 10.3389/fpls.2017.02218 ; PMID: 29375596
- Transcriptional Variation in Glucosinolate Biosynthetic Genes and Inducible Responses to Aphid Herbivory on Field-Grown Arabidopsis thaliana. DOI: 10.3389/fgene.2019.00787 ; PMID: 31572432
- Glucosinolate Content in Dormant and Germinating Arabidopsis thaliana Seeds Is Affected by Non-Functional Alleles of Classical Myrosinase and Nitrile-Specifier Protein Genes. DOI: 10.3389/fpls.2019.01549 ; PMID: 31850033
- Multiple indole glucosinolates and myrosinases defend Arabidopsis against Tetranychus urticae herbivory. DOI: 10.1093/plphys/kiab247 ; PMID: 34618148
- Jasmonate regulates the FAMA/mediator complex subunit 8-THIOGLUCOSIDE GLUCOHYDROLASE 1 cascade and myrosinase activity. DOI: 10.1093/plphys/kiab283 ; PMID: 34608953
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- High light response of the thylakoid proteome in arabidopsis wild type and the ascorbate-deficient mutant vtc2-2. A comparative proteomics study. DOI: 10.1104/pp.106.080150 ; PMID: 16648217
- A sub-proteome of Arabidopsis thaliana mature stems trapped on Concanavalin A is enriched in cell wall glycoside hydrolases. DOI: 10.1093/jxb/erm082 ; PMID: 17526915
- Proteome analysis of Arabidopsis leaf peroxisomes reveals novel targeting peptides, metabolic pathways, and defense mechanisms. DOI: 10.1105/tpc.107.050989 ; PMID: 17951448
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. DOI: 10.1016/j.phytochem.2008.04.007 ; PMID: 18538804
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- High light response of the thylakoid proteome in arabidopsis wild type and the ascorbate-deficient mutant vtc2-2. A comparative proteomics study. DOI: 10.1104/pp.106.080150 ; PMID: 16648217
- A sub-proteome of Arabidopsis thaliana mature stems trapped on Concanavalin A is enriched in cell wall glycoside hydrolases. DOI: 10.1093/jxb/erm082 ; PMID: 17526915
- Proteome analysis of Arabidopsis leaf peroxisomes reveals novel targeting peptides, metabolic pathways, and defense mechanisms. DOI: 10.1105/tpc.107.050989 ; PMID: 17951448
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. DOI: 10.1016/j.phytochem.2008.04.007 ; PMID: 18538804
Gene Resources
- UniProt: A0A178U7L7
- EMBL: LUHQ01000005
- AlphaFoldDB: A0A178U7L7
- EnsemblPlants: AT5G26000.1
- Gramene: AT5G26000.1
- KEGG: ath:AT5G26000
- Orthologous matrix: MRFLVED
- ExpressionAtlas: AT5G26000
- InterPro: IPR001360, IPR017853, IPR018120
- PANTHER: PTHR10353, PTHR10353:SF218
- SUPFAM: SSF51445
- PROSITE: PS00572, PS00653
- Gene3D: 3.20.20.80
- SWISS-MODEL: A0A178U7L7
Sequences
cDNA Sequence
- >AT5G26000.2
CCATGCAACACAAAAACATACACACTACTAATAAACCATGAAGCTTCTTATGCTCGCCTTTGTTTTTCTATTAGCTTTGGCGACTTGTAAAGGTGACGAGTTTGTTTGTGAAGAGAACGAGCCATTCACATGTAACCAAACTAAACTTTTCAACAGTGGCAATTTCGAAAAAGGCTTCATCTTCGGTGTTGCATCTTCTGCTTACCAGGTGGAAGGCGGTAGAGGCCGTGGACTTAACGTTTGGGATAGCTTCACTCACCGATTCCCAGAGAAAGGTGGAGCTGATTTGGGAAATGGAGACACTACTTGTGACTCATATACTCTTTGGCAGAAAGATATAGACGTGATGGACGAGCTCAACTCTACTGGCTACAGATTCTCCATTGCGTGGTCAAGACTCCTTCCAAAAGGAAAGAGGAGCAGGGGAGTGAACCCAGGAGCTATTAAGTACTACAACGGTCTCATAGATGGCCTCGTCGCAAAGAATATGACGCCCTTTGTTACCCTCTTTCATTGGGACCTTCCTCAAACACTACAAGATGAATATAACGGTTTCTTGAACAAAACGATCGTAGACGATTTCAAGGATTACGCGGATCTATGTTTCGAGTTATTTGGTGATAGGGTAAAGAACTGGATCACCATCAACCAGCTATACACAGTGCCTACTAGAGGATATGCATTGGGAACAGATGCACCCGGTCGATGTTCTCCTAAGATTGACGTTAGATGTCCCGGCGGAAATTCGTCAACAGAACCCTATATTGTTGCACATAACCAGCTTCTTGCTCATGCAGCGGCCGTTGATGTTTACAGGACGAAATATAAGGATGACCAAAAAGGTATGATTGGACCAGTGATGATAACTAGATGGTTTCTTCCATTTGATCATAGTCAAGAGAGCAAAGATGCAACTGAGCGGGCTAAAATATTTTTCCATGGATGGTTCATGGGGCCTCTAACAGAAGGTAAATACCCAGACATCATGAGGGAATATGTTGGTGATCGGCTTCCAGAGTTCAGTGAAACAGAAGCCGCACTTGTAAAGGGTTCATATGATTTTCTTGGTCTCAACTATTACGTCACTCAATACGCCCAAAATAATCAGACGATTGTTCCTTCGGACGTACACACTGCCTTGATGGACTCACGCACAACTCTCACATCTAAAAATGCAACTGGTCATGCTCCTGGTCCACCGTTCAATGCAGCCAGTTACTACTACCCAAAAGGCATTTACTACGTAATGGATTACTTCAAAACCACTTACGGTGACCCTTTAATATATGTCACTGAGAATGGATTTAGTACCCCAGGTGATGAGGACTTTGAGAAGGCTACTGCCGATTACAAGCGGATTGATTATCTCTGTAGTCATCTCTGTTTCCTCAGTAAAGTCATCAAGTGAAAGAATGTCAACGTGAAAGGATATTTTGCTTGGTCTCTTGGGGATAATTACGAATTCTGTAACGGATTTACCGTCAGATTCGGACTAAGTTACGTTGATTTCGCAAATATCACTGGTGATAGAGACCTCAAAGCATCTGGCAAATGGTTCCAGAAGTTCATAAACGTTACCGACGAAGACTCTACGAACCAAGATCTACTCCGCTCAAGCGTCTCCTCCAAGAACCGTGATCGGAAGAGTCTTGCAGATGCATGAAATATCCAATCCACTATATGTCCACCAAGATCATCTTCATGTTTCCTCTTTCTACTTGCTCCATAGATAAGGAGCTTTTTCTACCATATGTATTAAAATAAAATCCTAATAAAAGATGATCAATAATAATAAAGACTTTGTTTACTACATTTATGTTGGAAGAGAAAAGAACC - >AT5G26000.1
CCATGCAACACAAAAACATACACACTACTAATAAACCATGAAGCTTCTTATGCTCGCCTTTGTTTTTCTATTAGCTTTGGCGACTTGTAAAGGTGACGAGTTTGTTTGTGAAGAGAACGAGCCATTCACATGTAACCAAACTAAACTTTTCAACAGTGGCAATTTCGAAAAAGGCTTCATCTTCGGTGTTGCATCTTCTGCTTACCAGGTGGAAGGCGGTAGAGGCCGTGGACTTAACGTTTGGGATAGCTTCACTCACCGATTCCCAGAGAAAGGTGGAGCTGATTTGGGAAATGGAGACACTACTTGTGACTCATATACTCTTTGGCAGAAAGATATAGACGTGATGGACGAGCTCAACTCTACTGGCTACAGATTCTCCATTGCGTGGTCAAGACTCCTTCCAAAAGGAAAGAGGAGCAGGGGAGTGAACCCAGGAGCTATTAAGTACTACAACGGTCTCATAGATGGCCTCGTCGCAAAGAATATGACGCCCTTTGTTACCCTCTTTCATTGGGACCTTCCTCAAACACTACAAGATGAATATAACGGTTTCTTGAACAAAACGATCGTAGACGATTTCAAGGATTACGCGGATCTATGTTTCGAGTTATTTGGTGATAGGGTAAAGAACTGGATCACCATCAACCAGCTATACACAGTGCCTACTAGAGGATATGCATTGGGAACAGATGCACCCGGTCGATGTTCTCCTAAGATTGACGTTAGATGTCCCGGCGGAAATTCGTCAACAGAACCCTATATTGTTGCACATAACCAGCTTCTTGCTCATGCAGCGGCCGTTGATGTTTACAGGACGAAATATAAGGATGACCAAAAAGGTATGATTGGACCAGTGATGATAACTAGATGGTTTCTTCCATTTGATCATAGTCAAGAGAGCAAAGATGCAACTGAGCGGGCTAAAATATTTTTCCATGGATGGTTCATGGGGCCTCTAACAGAAGGTAAATACCCAGACATCATGAGGGAATATGTTGGTGATCGGCTTCCAGAGTTCAGTGAAACAGAAGCCGCACTTGTAAAGGGTTCATATGATTTTCTTGGTCTCAACTATTACGTCACTCAATACGCCCAAAATAATCAGACGATTGTTCCTTCGGACGTACACACTGCCTTGATGGACTCACGCACAACTCTCACATCTAAAAATGCAACTGGTCATGCTCCTGGTCCACCGTTCAATGCAGCCAGTTACTACTACCCAAAAGGCATTTACTACGTAATGGATTACTTCAAAACCACTTACGGTGACCCTTTAATATATGTCACTGAGAATGGATTTAGTACCCCAGGTGATGAGGACTTTGAGAAGGCTACTGCCGATTACAAGCGGATTGATTATCTCTGTAGTCATCTCTGTTTCCTCAGTAAAGTCATCAAGTGAAAGAATGTCAACGTGAAAGGATATTTTGCTTGGTCTCTTGGGGATAATTACGAATTCTGTAACGGATTTACCGTCAGATTCGGACTAAGTTACGTTGATTTCGCAAATATCACTGGTGATAGAGACCTCAAAGCATCTGGCAAATGGTTCCAGAAGTTCATAAACGTTACCGACGAAGACTCTACGAACCAAGATCTACTCCGCTCAAGCGTCTCCTCCAAGAACCGTGATCGGAAGAGTCTTGCAGATGCATGAAATATCCAATCCACTATATGTCCACCAAGATCATCTTCATGTTTCCTCTTTCTACTTGCTCCATAGATAAGGAGCTTTTTCTACCATATGTATTAAAATAAAATCCTAATAAAAGATGATCAATAATAATAAAGACTTTGTTTACTACATTTATGTTGGAAGAGAAAAGAACC
CDS Sequence
Protein Sequence