Gene Details:
- Gene ID: AT5G25090
- Gene Symbol: AtENODL13, ENODL13
- Gene Name: early nodulin-like protein 13
- Description: early nodulin-like protein 13;(source:Araport11)
- TAIR Accession: locus:2179240
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0019219 — acts upstream of or within — regulation of nucleobase-containing compound metabolic process
- GO:0009055 — enables — electron transfer activity
- GO:0009536 — located in — plastid
- GO:0005886 — located in — plasma membrane
- GO:0016020 — located in — membrane
- GO:0009506 — located in — plasmodesma
Function-related keywords:
Literature:
- Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis. DOI: 10.1104/pp.010884 ; PMID: 12068095
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- Microarray analysis of genes that respond to gamma-irradiation in Arabidopsis. DOI: 10.1021/jf0486895 ; PMID: 15713015
- An early nodulin-like protein accumulates in the sieve element plasma membrane of Arabidopsis. DOI: 10.1104/pp.106.092296 ; PMID: 17293437
- Genome-wide identification, structure and expression studies, and mutant collection of 22 early nodulin-like protein genes in Arabidopsis. DOI: 10.1271/bbb.90407 ; PMID: 19897921
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequences:
cDNA Sequence
- >AT5G25090.1
AAATAAGCAACATAAAATCTTTCTCTTTATCTCTATATAGCTCATACACAAACTTCATTCTAATGGCTCAGAGAACTCTTGTTGCAACATTTTTTCTAATCTTCTTCTTGTTGACTAATCTCGTCTGTAGCAAAGAGATTATTGTCGGAGGCAAAACCAGCTCCTGGAAGATCCCTTCTTCGCCTTCTGAGTCCCTAAACAAATGGGCTGAGAGTTTACGGTTTCGCGTTGGCGACACTCTCGTGTGGAAGTACGATGAGGAAAAGGACTCGGTTTTGCAAGTGACGAAAGATGCATACATTAACTGCAACACCACAAACCCAGCAGCTAACTACAGCAATGGAGATACTAAAGTGAAGCTAGAGAGATCTGGTCCTTACTTCTTCATCAGCGGCTCTAAAAGCAACTGCGTTGAAGGTGAGAAGCTTCATATTGTTGTCATGTCCTCTCGTGGTGGCCACACCGGTGGTTTTTTTACTGGTTCTTCTCCTTCTCCTGCACCATCTCCAGCTTTGTTAGGAGCTCCCACTGTGGCTCCAGCCAGTGGTGGCTCTGCTTCTTCTTTAACTCGCCAAGTTGGGGTTTTGGGATTTGTTGGATTATTAGCGATTGTTTTGCTTTGATTTAACCTGCTTTGTTCAACTTCTATCTCTGCTTTTTGATTCTTTGATCCACAAGATTTGTTGAATTCTTTTGCCTTTTAAATATTAATGTTATTTCCG
CDS Sequence
Protein Sequence