Information report for AT5G24800
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0003015 — primary root differentiation zone — zona de diferenciación de la raíz primary (Spanish, exact), 一次根分化帯（層） (Japanese, exact)
- PO:0005417 — phloem — floema (Spanish, exact), portion of phloem tissue (exact), 師部、師管 (Japanese, exact)
- PO:0006203 — pericycle — periciclo (Spanish, exact), portion of pericycle tissue (exact), portion of pericyclic tissue (exact), 内鞘 (Japanese, exact)
- PO:0025257 — primary root elongation zone — zona de elongación de la raíz primaria (Spanish, exact), 一次根伸長帯（層） (Japanese, exact)
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0006355 — involved in — regulation of DNA-templated transcription
- GO:0005634 — located in — nucleus
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0071333 — involved in — cellular response to glucose stimulus
- GO:0005515 — enables — protein binding
- GO:0046982 — enables — protein heterodimerization activity
- GO:0042803 — enables — protein homodimerization activity
Functional Keywords
Literature and News
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- bZIP transcription factors in Arabidopsis. DOI: 10.1016/s1360-1385(01)02223-3 ; PMID: 11906833
- Global identification of target genes regulated by APETALA3 and PISTILLATA floral homeotic gene action. DOI: 10.1105/tpc.006353 ; PMID: 12509532
- Evolutionary pattern of angiosperm bZIP factors homologous to the maize Opaque2 regulatory protein. DOI: 10.1007/s00239-002-2386-1 ; PMID: 12569427
- When defense pathways collide. The response of Arabidopsis to a combination of drought and heat stress. DOI: 10.1104/pp.103.033431 ; PMID: 15047901
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- Dimerization specificity of all 67 B-ZIP motifs in Arabidopsis thaliana: a comparison to Homo sapiens B-ZIP motifs. DOI: 10.1093/nar/gkh653 ; PMID: 15226410
- Global transcript profiling of primary stems from Arabidopsis thaliana identifies candidate genes for missing links in lignin biosynthesis and transcriptional regulators of fiber differentiation. DOI: 10.1111/j.1365-313X.2005.02403.x ; PMID: 15918878
- Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays. DOI: 10.1007/s10142-005-0014-z ; PMID: 16463051
- Type III effectors orchestrate a complex interplay between transcriptional networks to modify basal defence responses during pathogenesis and resistance. DOI: 10.1111/j.1365-313X.2006.02672.x ; PMID: 16553893
- Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots. DOI: 10.1073/pnas.0510607103 ; PMID: 16581911
- Cross-species annotation of basic leucine zipper factor interactions: Insight into the evolution of closed interaction networks. DOI: 10.1093/molbev/msl022 ; PMID: 16731568
- Two-hybrid protein-protein interaction analysis in Arabidopsis protoplasts: establishment of a heterodimerization map of group C and group S bZIP transcription factors. DOI: 10.1111/j.1365-313X.2006.02731.x ; PMID: 16709202
- Temporal responses of transcripts, enzyme activities and metabolites after adding sucrose to carbon-deprived Arabidopsis seedlings. DOI: 10.1111/j.1365-313X.2006.02979.x ; PMID: 17217462
- An early response regulatory cluster induced by low temperature and hydrogen peroxide in seedlings of chilling-tolerant japonica rice. DOI: 10.1186/1471-2164-8-175 ; PMID: 17577400
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- The G-Box Transcriptional Regulatory Code in Arabidopsis. DOI: 10.1104/pp.17.01086 ; PMID: 28864470
- Snf1-RELATED KINASE1-Controlled C/S(1)-bZIP Signaling Activates Alternative Mitochondrial Metabolic Pathways to Ensure Plant Survival in Extended Darkness. DOI: 10.1105/tpc.17.00414 ; PMID: 29348240
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- bZIP transcription factors in Arabidopsis. DOI: 10.1016/s1360-1385(01)02223-3 ; PMID: 11906833
- Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots. DOI: 10.1073/pnas.0510607103 ; PMID: 16581911
Gene Resources
- UniProt: A0A178UG19
- EMBL: CACRSJ010000110, LR881470, LUHQ01000005
- AlphaFoldDB: A0A178UG19
- EnsemblPlants: AT5G24800.1
- Gramene: AT5G24800.1
- KEGG: ath:AT5G24800
- Orthologous matrix: FNDASQH
- ExpressionAtlas: AT5G24800
- InterPro: IPR004827, IPR045314, IPR046347
- PANTHER: PTHR46408, PTHR46408:SF8
- SUPFAM: SSF57959
- PROSITE: PS00036, PS50217
- Gene3D: 1.20.5.170
- SWISS-MODEL: A0A178UG19
- Conserved Domain Database: cd14702
Sequences
cDNA Sequence
- >AT5G24800.1
CCCTCTCCTCTCTTTTCCAACCAATTCTCTTCTTTCTTGTGTGTTCACATTCAAAGAAAATGGATAATCACACAGCTAAAGACATTGGTATGAAGAGAAGTGCTTCTGAGCTGGCTCTACAAGAGTATCTCACTACAAGCCCTCTAGACCCTTGTTTCGACCTCATGAACCGGGATTACACTTGTGAGTTAAGAGATAGTCTTTTGTGGTCTGAGGGATTGTTTCCGGCTGGACCTTTTCGCGATGCACAGTCCTCAATCTGCGAGAATCTGTCAGCTGATAGTCCAGTGTCAGCCAATAAACCTGAGGTAAGAGGAGGAGTTAGGAGAACCACAAGTGGATCTTCTCATGTTAACTCTGATGACGAAGATGCCGAGACAGAAGCAGGGCAATCTGAAATGACTAATGATCCCAATGATCTGAAACGTATTAGAAGGATGAACTCAAACAGGGAATCAGCAAAGAGGTCGAGGAGAAGGAAGCAAGAGTACTTGGTAGATCTTGAGACTCAGGTTGATTCTTTGAAAGGCGATAACTCAACACTGTACAAGCAGCTCATAGACGCAACACAACAGTTTCGTAGCGCTGGAACAAATAACAGAGTTCTCAAATCAGATGTTGAAACTCTGAGAGTCAAGGTGAAACTAGCAGAAGATTTGGTAGCGAGAGGGTCACTCACTAGCAGCTTGAATCAACTTCTACAAACTCATCTAAGTCCACCATCACACTCCATCAGCAGTCTGCACTACACGGGAAATACCTCGCCCGCCATTACAGTCCACAGTGACCAATCTTTGTTCCCTGGAATGACACTTTCTGGACAGAACTCAAGCCCTGGACTTGGTAATGTATCCAGTGAAGCTGTTAGCTGCGTCTCAGACATCTGGCCATGACTCTCTTTCTTCAGAACATGTAATGATCACTCAGCGAATTTCCTGTATGTGTTTCGCTATAGAACTAGAAACATATAATGAAAGCAGCATGTTCGTTAAATAAACTCAAGTTTCGTCAACATATACTT
CDS Sequence
Protein Sequence