Gene Details:
- Gene ID: AT5G24650
- Gene Symbol: HP30-2, Tric2
- Gene Name: hypothetical protein 30-2, tRNA import component 2
- Description: Mitochondrial import inner membrane translocase subunit Tim17/Tim22/Tim23 family protein;(source:Araport11)
- TAIR Accession: locus:2153959
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Gene Ontology:
- GO:0009941 — located in — chloroplast envelope
- GO:0045036 — involved in — protein targeting to chloroplast
- GO:0009507 — located in — chloroplast
- GO:0005744 — part of — TIM23 mitochondrial import inner membrane translocase complex
- GO:0005515 — enables — protein binding
- GO:0042721 — part of — TIM22 mitochondrial import inner membrane insertion complex
- GO:0009706 — located in — chloroplast inner membrane
- GO:0009706 — is active in — chloroplast inner membrane
- GO:0016031 — acts upstream of or within — tRNA import into mitochondrion
- GO:0045039 — involved in — protein insertion into mitochondrial inner membrane
- GO:0005886 — located in — plasma membrane
- GO:0005739 — located in — mitochondrion
- GO:0009536 — located in — plastid
- GO:0005773 — located in — vacuole
- GO:0043621 — enables — protein self-association
- GO:0008320 — enables — protein transmembrane transporter activity
- GO:0000325 — located in — plant-type vacuole
- GO:0007005 — acts upstream of or within — mitochondrion organization
Germplasm Phenotype:
- SALK_136524 — Etiolated seedlings show reduced viability during greening.
- SALK_136525 — Etiolated seedlings show reduced viability during greening.
- hrg2-1 — 42 hrs to germinate; reduced H2O2 scavenging by germinating seed.
Function-related keywords:
Literature:
- Large-scale characterization of integral proteins from Arabidopsis vacuolar membrane by two-dimensional liquid chromatography. DOI: 10.1002/pmic.200300607 ; PMID: 14760709
- Identification of new intrinsic proteins in Arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M400001-MCP200 ; PMID: 15060130
- Proteome analysis of the rice etioplast: metabolic and regulatory networks and novel protein functions. DOI: 10.1074/mcp.M500018-MCP200 ; PMID: 15901827
- Novel tonoplast transporters identified using a proteomic approach with vacuoles isolated from cauliflower buds. DOI: 10.1104/pp.107.096917 ; PMID: 17660356
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Plant-Specific Preprotein and Amino Acid Transporter Proteins Are Required for tRNA Import into Mitochondria. DOI: 10.1104/pp.16.01519 ; PMID: 27789739
- tRNA-Dependent Import of a Transit Sequence-Less Aminoacyl-tRNA Synthetase (LeuRS2) into the Mitochondria of Arabidopsis. DOI: 10.3390/ijms22083808 ; PMID: 33916944
- H(2)O(2) response gene 1/2 are novel sensors or responders of H(2)O(2) and involve in maintaining embryonic root meristem activity in Arabidopsis thaliana. DOI: 10.1016/j.plantsci.2021.110981 ; PMID: 34315597
- Proteomics of the chloroplast envelope membranes from Arabidopsis thaliana. DOI: 10.1074/mcp.M300030-MCP200 ; PMID: 12766230
- Proteomic study of the Arabidopsis thaliana chloroplastic envelope membrane utilizing alternatives to traditional two-dimensional electrophoresis. DOI: 10.1021/pr034025j ; PMID: 12938931
- Large-scale characterization of integral proteins from Arabidopsis vacuolar membrane by two-dimensional liquid chromatography. DOI: 10.1002/pmic.200300607 ; PMID: 14760709
- Identification of new intrinsic proteins in Arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M400001-MCP200 ; PMID: 15060130
- Characterization of the preprotein and amino acid transporter gene family in Arabidopsis. DOI: 10.1104/pp.106.090688 ; PMID: 17098851
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
Sequences:
cDNA Sequence
- >AT5G24650.1
AATAATACATCCGGTAGAAACACGGAACCGGCATAAATGAGGGAGATAAGGAGAAGAAGAAGCGAAAGAATAAAAGTGTGACAAATTAAGAAGAGAGAAATGGGGAAAGACGGAGAAGGAGACAAGAAGCGAGAAACAATGGCGGTGATGAGCTTAATGAAGGATCAACAGAATCCAATTCAACAGTTTCAAGTCAAATTCAAGGAGATTGAGACTGGTTTCAAGTCGTGGTTATCAAAACAGAAGTTACCGGTGGAAGCCGCCGTTGTCACGGCCATGGGTGGTGTTCAGGGAGCTTTTATCGGTGGTTTAATGGGAACTTTATCTCCTGAAATGCCTCAGGCTGGTATTGACCCTCAAGCTATGGCTTCGCTAAAGCAAACTCAGGCTCTTGTTGGTGGGCCTTTGGTTCAAGCTCGGAACTTTGCTGCTATAACTGGTGTTAATGCTGGTATTGCTTGTGTTATGAAACGGATTAGAGGCAAGGAGGATTTAGAATCTGCTGTGGTCGCAGCATTCGGATCTGGAGTTGCATATTCTCTTGTGAGCGCAGGATTACAAGGACAGCCTATGAATGCAATCACCACTGCTGCTGGTTTCGCTGTTTTTCAAGGAGTGTTTTTCAAGTTGGGTGAAAGGTTCTCTAAACCAAGTGTTGAAGATCCATATTACACCCGGGGAAGATCTATGTTGTTGAAACTGGGTCTAGAGAAGTATGAGAAGAACTTCAAGAAAGGTTTATTAGCTGACCCAACTCTGCCATTGCTCACTGATAGCGCGCTAAGAGACGTGAGCATCCCGCCTGGACCAAGGCTACTGATACTTGATCACATCCAAAGGGACCCTGAGCTAAAGGGCAAGCGGGGAAGTCGTGGTTGAGACTTGAGAGCCTCTCTCCTTCTTCTGCAGAATCTTTGTTGTTGTAAGATGTTATAAGGATCTCAAGCACCTATTATTCTTAAATATTATTGGTTGATGTTGCTAGCAAGAAAAATTGAATACAACCTTAAAATATGGTCGCGATATCTAAAAGTTCACACAAAGTTTTCTATATGTACCTGGAAATAGTTGAATTAATGTATGTATAACCCAATAAAAGCTCTTAATCCAGCAGTAATGTGATC
CDS Sequence
Protein Sequence