Information report for AT5G24400
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025025 — root system — sistema de raíz (Spanish, exact), 根系 (Japanese, exact), root (broad)
- GO:0009507 — located in — chloroplast
- GO:0009570 — located in — chloroplast stroma
- GO:0009793 — acts upstream of or within — embryo development ending in seed dormancy
- GO:0042742 — acts upstream of or within — defense response to bacterium
- GO:0005975 — involved in — carbohydrate metabolic process
- GO:0017057 — enables — 6-phosphogluconolactonase activity
- GO:0009051 — involved in — pentose-phosphate shunt, oxidative branch
- GO:0002229 — acts upstream of or within — defense response to oomycetes
- GO:0005515 — enables — protein binding
- GO:0005777 — located in — peroxisome
- GO:0071461 — acts upstream of or within — cellular response to redox state
- CS2105660 — Sugar sensitive seedling
Functional Keywords
Literature and News
- Proteomics of loosely bound cell wall proteins of Arabidopsis thaliana cell suspension cultures: a critical analysis. DOI: 10.1002/elps.200305608 ; PMID: 14595688
- Functional differentiation of peroxisomes revealed by expression profiles of peroxisomal genes in Arabidopsis thaliana. DOI: 10.1093/pcp/pcg173 ; PMID: 14701923
- Identification of genes required for embryo development in Arabidopsis. DOI: 10.1104/pp.104.045179 ; PMID: 15266054
- AraPerox. A database of putative Arabidopsis proteins from plant peroxisomes. DOI: 10.1104/pp.104.043695 ; PMID: 15333753
- Identification of Arabidopsis salt and osmotic stress responsive proteins using two-dimensional difference gel electrophoresis and mass spectrometry. DOI: 10.1002/pmic.200401282 ; PMID: 16254930
- Proteome analysis of Arabidopsis leaf peroxisomes reveals novel targeting peptides, metabolic pathways, and defense mechanisms. DOI: 10.1105/tpc.107.050989 ; PMID: 17951448
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Identification of nuclear genes encoding chloroplast-localized proteins required for embryo development in Arabidopsis. DOI: 10.1104/pp.110.168120 ; PMID: 21139083
- Dual-targeting of Arabidopsis 6-phosphogluconolactonase 3 (PGL3) to chloroplasts and peroxisomes involves interaction with Trx m2 in the cytosol. DOI: 10.1093/mp/sst126 ; PMID: 24008768
- Genome-wide identification of EMBRYO-DEFECTIVE (EMB) genes required for growth and development in Arabidopsis. DOI: 10.1111/nph.16071 ; PMID: 31334862
- The Arabidopsis Plastidial Glucose-6-Phosphate Transporter GPT1 is Dually Targeted to Peroxisomes via the Endoplasmic Reticulum. DOI: 10.1105/tpc.19.00959 ; PMID: 32111666
- Proteome analysis of Arabidopsis leaf peroxisomes reveals novel targeting peptides, metabolic pathways, and defense mechanisms. DOI: 10.1105/tpc.107.050989 ; PMID: 17951448
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Analysis of the Arabidopsis cytosolic proteome highlights subcellular partitioning of central plant metabolism. DOI: 10.1021/pr1009433 ; PMID: 21166475
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A654G497
- EMBL: CACRSJ010000110
- AlphaFoldDB: A0A654G497
- EnsemblPlants: AT5G24400.1
- Gramene: AT5G24400.1
- KEGG: ath:AT5G24400
- Orthologous matrix: IAMSQST
- ExpressionAtlas: AT5G24400
- InterPro: IPR005900, IPR006148, IPR037171
- PANTHER: PTHR11054, PTHR11054:SF22
- SUPFAM: SSF100950
- Gene3D: 3.40.50.1360
- SWISS-MODEL: A0A654G497
- Conserved Domain Database: cd01400
Sequences
cDNA Sequence
- >AT5G24400.1
CGGAACCAAAGATCTAGATCTACACATTAGTTCATAAGCTGGACCAGACTCATAAACAAACTAACAAAACACAGGTTTGGTCGGAGAAGGCTTTATTAATCCACTTGTCCTCCTCTCAGACTCTACAAAGTCAAAGTTGTTCACTTTACCTATAAAAACGCTCTCTCACTTTCTTTTCAATGGCTTCTTCTTCTTGTTTCCTTCGCTCGATTCTCTTCTCTTCTCCTACTAACCTTCGTTCAAATCACCATCTCCCCACTTTCTTCCCCAAGAATTATCTCATTTGCTCTCATTCCACTTCTTCTCGCTTCGAATCGCTCTCGGTTTCATCGATCGGAACTGGATCTACCAAGAAATCATCCGATACTCGGAGAAAGGTAAAGAGCATGGCTACGACAAATATAGGAAAGGAGGAGAAGAAAAGAGTCGAGATTTATGATCTCGAAGAGAATTTAGTGATTGATTTGGCTAAATTCACAGCAGATCTCTCCGATAAGTTTTGTAAAGAGAGAGGCGCTTTCACCGTCGTTGTCTCCGGTGGCTCTCTCATCAAATCACTCCGGAAATTAGTAGAATCTCCTTACGTTGATTCTATAGATTGGGCAAGGTGGCATTTTTTCTGGGTTGACGAGAGAGTTGTTCCCAAGAATCACGATGATAGCAACTATAAACTCGCTTATGATAGTTTTCTATCCAAGGTACCAATTCCGCCTGGAAATGTATATGCAATCAACGAAGCCCTCTCCGCTGAGGCTGCAGCGGATGATTACGAGACCTGCCTCAAACATTTGGTCAACACCAACATTCTCCGTGTATCTGAATCAACTGGCTTTCCCAAATTTGATCTCATGCTTCTAGGTATGGGACCTGATGGTCATGTGGCATCATTATTCCCTGGGCATGGTCTCTGCAACGAGAGCAAGAAATGGGTAGTTTCAATCTCTGACTCTCCAAAACCACCGTCTGAGAGAATCACCTTCACGTTCCCGGTCATCAACTCATCTGCACATGTAGCTCTAGTTGTTTGCGGTTCTGGGAAAGCTGAAGCTGTGGAGGCAGCTTTAAAGAAGACTGGGAATGTACCACCTGCTGGTTCTGTTTCTGCTGAAGACGAGTTGGTTTGGTTCCTGGACAAACCAGCATCTTCCAAGCTCTAAAAACAGGTGGTATGCTTCCCATTCCAGTGAACTTACCAATGTGACTAGTCCGGTTTAGTTTTTGGATTTTGACTCTTTGGTTCTCTCCATTTATGTTGTGGGAAGAGACTGTTGTGATAAAAGCGTGTACTTTACATGGAAATAATGAACTAATCAATGGTTTCTCTGATTTGTTTTGGTGTATTTTGGTTAAAATCTATCGGAACCAACACTCTCCAATTGTTGTTTTGACTAAAGACTATAACTGATTGTGTAGTATGCTCCGGATCGGACTAAAGTCGAATTTGTC
CDS Sequence
Protein Sequence