Information report for AT5G23660
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0005417 — phloem — floema (Spanish, exact), portion of phloem tissue (exact), 師部、師管 (Japanese, exact)
- CS68997 — Reduced embryo size.
- CS68998 — Wrinkled seed phenotype caused by severe seed defects including the following: retarded embryo development, reduced seed weight, reduced starch and lipid content, and starch accumulation in the seed coat, but not the embryo.
- CS69005 — No visible phenotype.
- CS69006 — No visible phenotype.
- CS69007 — No visible phenotype.
- CS69008 — No visible phenotype.
- CS69009 — Reduced embryo size compared to wildtype; however, most of the defects in embryo size is rescued by complementation of the atsweet11;12;15 triple mutant.
- CS69010 — Reduced embryo size compared to wildtype; however, most of the defects in embryo size is rescued by complementation of the atsweet11;12;15 triple mutant.
Literature and News
- Comparative genomics in salt tolerance between Arabidopsis and aRabidopsis-related halophyte salt cress using Arabidopsis microarray. DOI: 10.1104/pp.104.039909 ; PMID: 15247402
- Membrane-associated transcripts in Arabidopsis; their isolation and characterization by DNA microarray analysis and bioinformatics. DOI: 10.1111/j.1365-313X.2006.02724.x ; PMID: 16640606
- Mining the Arabidopsis thaliana genome for highly-divergent seven transmembrane receptors. DOI: 10.1186/gb-2006-7-10-r96 ; PMID: 17064408
- The EAR-motif of the Cys2/His2-type zinc finger protein Zat7 plays a key role in the defense response of Arabidopsis to salinity stress. DOI: 10.1074/jbc.M611093200 ; PMID: 17259181
- Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. DOI: 10.1104/pp.107.111286 ; PMID: 18218973
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Sucrose efflux mediated by SWEET proteins as a key step for phloem transport. DOI: 10.1126/science.1213351 ; PMID: 22157085
- Photoassimilation, assimilate translocation and plasmodesmal biogenesis in the source leaves of Arabidopsis thaliana grown under an increased atmospheric CO2 concentration. DOI: 10.1093/pcp/pcu004 ; PMID: 24406629
- Water Deficit Enhances C Export to the Roots in Arabidopsis thaliana Plants with Contribution of Sucrose Transporters in Both Shoot and Roots. DOI: 10.1104/pp.15.01926 ; PMID: 26802041
- Sugar Accumulation in Leaves of Arabidopsis sweet11/sweet12 Double Mutants Enhances Priming of the Salicylic Acid-Mediated Defense Response. DOI: 10.3389/fpls.2017.01378 ; PMID: 28848581
- Carbon source-sink relationship in Arabidopsis thaliana: the role of sucrose transporters. DOI: 10.1007/s00425-017-2807-4 ; PMID: 29138971
- Clubroot Disease Stimulates Early Steps of Phloem Differentiation and Recruits SWEET Sucrose Transporters within Developing Galls. DOI: 10.1105/tpc.18.00283 ; PMID: 30413655
- Salinity Effects on Sugar Homeostasis and Vascular Anatomy in the Stem of the Arabidopsis Thaliana Inflorescence. DOI: 10.3390/ijms20133167 ; PMID: 31261714
- Distinct identities of leaf phloem cells revealed by single cell transcriptomics. DOI: 10.1093/plcell/koaa060 ; PMID: 33955487
- Sugar export from Arabidopsis leaves: actors and regulatory strategies. DOI: 10.1093/jxb/erab241 ; PMID: 34037757
- The plant TOR kinase tunes autophagy and meristem activity for nutrient stress-induced developmental plasticity. DOI: 10.1093/plcell/koac201 ; PMID: 35792878
Gene Resources
Sequences
cDNA Sequence
- >AT5G23660.1
CACACACTTCCCTTGTTCATTCTCAAGACATCCCCTCTATAAATACTTGAAGTCATCAGAATGCTAAAAAGTCGTGCCATTAGCCTTTGATTTCAGAAAAAACACTTACAAAGCTGATATCTTTCTTACTACTTCGAAGAAATCTTCTTCTCCCTTCCAAAAAAACAATCCCTAAACCCGGAACCAAAGATCGACATTCATGGCTCTCTTCGACACTCATAACACATGGGCCTTTGTTTTCGGCTTGCTCGGAAACCTCATTTCCTTTGCTGTTTTCCTCTCTCCCGTGCCAACGTTCTATAGGATTTGTAAGAAGAAAACCACAGAAGGATTTCAATCTATTCCCTATGTGGTGGCGCTCTTCAGCGCGATGCTTTGGCTCTACTACGCTACTCAGAAGAAAGATGTCTTCCTTCTCGTCACCATCAACAGCTTTGGTTGCTTCATTGAAACCATATACATCTCCATCTTTGTTGCCTTCGCATCCAAGAAAGCCCGAATGCTAACGGTGAAGCTCTTGTTGCTAATGAACTTTGGAGGGTTCTGTTTGATTCTCCTCCTCTGCCAATTCTTGGCAAAAGGAACCACACGTGCGAAGATCATTGGAGGTATCTGTGTCGGATTCTCTGTCTGCGTTTTTGCTGCGCCGCTTAGCATTATCAGAACGGTGATAAAGACGAAAAGTGTGGAGTACATGCCGTTTAGCTTATCCTTGACTCTTACCATCAGTGCGGTCATATGGCTCCTTTATGGTCTTGCTCTTAAGGATATCTATGTTGCCTTCCCAAACGTGATTGGGTTTGTTCTAGGTGCACTTCAAATGATACTCTATGTGGTTTACAAATACTGCAAAACGCCGTCGGATTTGGTTGAGAAAGAACTTGAGGCTGCGAAATTGCCAGAAGTGAGCATCGATATGGTGAAGTTAGGTACACTCACATCTCCTGAACCAGTAGCGATCACCGTCGTCCGATCGGTGAACACATGTAACTGTAACGATCGAAATGCTGAGATTGAAAATGGTCAGGGAGTTAGAAACAGTGCTGCAACTACTTGAGTTTGCCCAAGAAACCCTAATAAGAAACCTATTTGTTGACTATTTTGACTTTGTACCCTTCTTGATATACCTATCAATCACCATTGTCCACGTGTACTAGTTTCGTTGTAGTAATTTTCAAAGTTTATCGAAGTATGCGTATTCGAGGATTAATTAAATCGGGAATTACATTTTCCTGAGTTAATTTTTTCTCTTTTTCTTTTACTTATGGGACAATGTAATGAAACTATCTGTTGCATATAAATATTTTCCAAGTTGAAAAGAAAATGAAAATTCTCAAGCAACTATC
CDS Sequence
Protein Sequence