Gene Details:
- Gene ID: AT5G23230
- Gene Symbol: NIC2
- Gene Name: nicotinamidase 2
- Description: nicotinamidase 2;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009089 — endosperm — albumen (exact), endosperma (Spanish, exact), 内胚乳、胚乳 (Japanese, exact)
Germplasm Phenotype:
- nic2-1 — A twofold decrease in nicotinamidase activity was seen in dry seed extracts of the mutant.
- nic2-1 — Freshly harvested nic2-1 seeds had a decreased level of poly(ADP)ribosylation compared to Ws seeds.
- nic2-1 — Mutant plants appeared to grow and develop normally. Their seeds phenotype have paler seed coat colour compared to wild-type Ws but the embryo was the same colour as WT.
- nic2-1 — Mutant seeds show hypersensitivity to nicotinamide (inhibitor of seed germination).
- nic2-1 — Significant 1.75-fold increase of NAD levels.
- nic2-1 — Treatment with 1 mM NADH promoted a small but significant increase in germination of mutant seeds.
- nic2-1 — Under moist-chilled (stratified) conditions, mutant seeds showed a slightly retarded germination, but there was no difference in the final percentage germination. However, in the absence of a moist chilling pre-treatment (non-stratified), germination was delayed and the germination potential of mutatn seeds was significantly lower than that of Ws, indicating a hyperdormant phenotype.
Function-related keywords:
- root , root , shoot system , plant embryo , endosperm
Literature:
- Bicistronic and fused monocistronic transcripts are derived from adjacent loci in the Arabidopsis genome. DOI: 10.1261/rna.7114505 ; PMID: 15659355
- Nicotinamidase participates in the salvage pathway of NAD biosynthesis in Arabidopsis. DOI: 10.1111/j.1365-313X.2006.03013.x ; PMID: 17335512
- Nicotinamidase activity is important for germination. DOI: 10.1111/j.1365-313X.2007.03151.x ; PMID: 17587307
- Interactome analysis reveals versatile functions of Arabidopsis COLD SHOCK DOMAIN PROTEIN 3 in RNA processing within the nucleus and cytoplasm. DOI: 10.1007/s12192-012-0398-3 ; PMID: 23334891
Sequences:
cDNA Sequence
- >AT5G23230.1
ACCGCCAGAAATGGCTTCTTCATCATCGAGAACGTACGAGACACGAAAGCGAGAGCCAAATCCTAAAATCGCAGCTCTTCTCGTCATCGATATGCAGAATCACTTCTACTCTATGGCTGAACCAATCCTCCAAAACGCTCTCACCACCATCGACATCTGCCGACGCGCTTCAATCCCCGTATTCTTCACGCGCCACAACCACAAATCCCCAACCGACCACGGCATGCTCGGAGAGTGGTGGAACGGCGATCTAATCCTCGACGGAACCACTGATTCCGAAATCATCCCGGAAATCAATCGCCAGGTCACCGGACCAGACGAAATCGTGGAGAAGAGCACGTACAGTGCGTTTAACAACACGCACCTTCAGGAGAAGCTGGACAAGATCGGAGTGAAGGAGGTGATCGTTATCGGAGTGATGACGAACCTATGCTGTGAGACGACGGCGCGTGAAGCGTTTGTAAAGGGGTTTAGGGTTTTTTTCTCGACGGACGCGACTGCGACGGTTAATGAAGAGCTTCACGAGGCTACTCTAATGAATCTCGCGTATGGCTTTGCTTATCTCGTCGATTGCGATAGACTCCGGCGAGGTCTACTCAGTAGTTAATAAAAGATGACTACACCTTTTGTTATTTGTGTTTATTGTGTGTGTAAGAGCATCTGGTGATAAAAGTGGAATGTCTTTAGTCGTTAGATTAAAATTTTAATTGATAAACTGTAAAAGTATTAAAACCAATAAGAAGGTGACATGTAG
CDS Sequence
Protein Sequence