Information report for AT5G23140
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Functional Keywords
Literature and News
- Analysis of the Arabidopsis mitochondrial proteome. DOI: 6919 ; PMID: 11743115
- Plant mitochondria contain proteolytic and regulatory subunits of the ATP-dependent Clp protease. DOI: 10.1023/a:1010677220323 ; PMID: 11352464
- Identification of a 350-kDa ClpP protease complex with 10 different Clp isoforms in chloroplasts of Arabidopsis thaliana. DOI: 10.1074/jbc.M010503200 ; PMID: 11278690
- The gene complement for proteolysis in the cyanobacterium Synechocystis sp. PCC 6803 and Arabidopsis thaliana chloroplasts. DOI: 10.1007/s00294-002-0309-8 ; PMID: 12185496
- Clp protease complexes from photosynthetic and non-photosynthetic plastids and mitochondria of plants, their predicted three-dimensional structures, and functional implications. DOI: 10.1074/jbc.M309212200 ; PMID: 14593120
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Coordination of nuclear and mitochondrial genome expression during mitochondrial biogenesis in Arabidopsis. DOI: 10.1105/tpc.104.030254 ; PMID: 15829605
- Cross genome comparisons of serine proteases in Arabidopsis and rice. DOI: 10.1186/1471-2164-7-200 ; PMID: 16895613
- Protease gene families in Populus and Arabidopsis. DOI: 10.1186/1471-2229-6-30 ; PMID: 17181860
- Alternative and effective proteomic analysis in Arabidopsis. DOI: 10.1002/pmic.200700346 ; PMID: 17828791
- Divalent metal ions in plant mitochondria and their role in interactions with proteins and oxidative stress-induced damage to respiratory function. DOI: 10.1104/pp.109.147942 ; PMID: 20018591
- Analysis of the Arabidopsis mitochondrial proteome. DOI: 6919 ; PMID: 11743115
- Chloroplast and mitochondrial proteases in Arabidopsis. A proposed nomenclature. DOI: 10.1104/pp.125.4.1912 ; PMID: 11299370
- Plant mitochondria contain proteolytic and regulatory subunits of the ATP-dependent Clp protease. DOI: 10.1023/a:1010677220323 ; PMID: 11352464
- Clp protease complexes from photosynthetic and non-photosynthetic plastids and mitochondria of plants, their predicted three-dimensional structures, and functional implications. DOI: 10.1074/jbc.M309212200 ; PMID: 14593120
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A178U8I8
- EMBL: CACRSJ010000110, CACSHJ010000096, LUHQ01000005
- AlphaFoldDB: A0A178U8I8
- EnsemblPlants: AT5G23140.1
- Gramene: AT5G23140.1
- KEGG: ath:AT5G23140
- Orthologous matrix: RDYWMKA
- ExpressionAtlas: AT5G23140
- InterPro: IPR001907, IPR018215, IPR023562
- PANTHER: PTHR10381, PTHR10381:SF11
- SUPFAM: SSF52096
- PROSITE: PS00381, PS00382
- Gene3D: 3.90.226.10
- OrthoDB: A0A178U8I8
- SWISS-MODEL: A0A178U8I8
- Conserved Domain Database: cd07017
Sequences
cDNA Sequence
- >AT5G23140.1
TAATTTTCCACTCCAATAAACAATTAAAAAAAGAATAAAAAAGAGAGTAACTCTTTAATAAATCTGAAATCCCTAAGCTCAAGACGAGTTTTCATTTCTCGAGCAATTTCACTCTTCCGAGAACAACCCTAGATTCCGATGATGAGGGGTCTCGTTTCCGGCGCCAAGATGCTATCATCAACCCCATCGTCGATGGCGACAAGCATCGCCACTGGTAGAAGAAGCTACAGTCTGATTCCGATGGTTATTGAGCACTCATCGCGAGGAGAGAGAGCTTACGACATCTTCTCTCGTTTGCTCAAGGAGCGTATTATCTGCATCAACGGTCCCATTAATGACGACACATCTCACGTCGTCGTCGCTCAGCTTCTTTACCTCGAGTCTGAGAATCCTTCGAAGCCGATCCATATGTATCTCAATTCCCCTGGCGGCCATGTCACCGCCGGTCTTGCAATTTATGATACTATGCAGTACATTCGTTCTCCTATTAGCACAATTTGTTTGGGTCAGGCTGCATCAATGGCTTCTCTTCTGTTGGCAGCGGGTGCCAAGGGGCAAAGGCGGTCACTTCCAAATGCAACTGTTATGATTCATCAGCCTTCAGGAGGATATAGTGGACAGGCTAAAGATATAACGATTCATACAAAACAGATTGTTCGTGTGTGGGATGCGTTAAATGAATTGTATGTCAAACACACGGGTCAACCTCTTGACGTGGTTGCGAATAACATGGATAGGGATCATTTCATGACTCCTGAAGAGGCTAAGGCGTTTGGAATAATCGATGAAGTGATTGATGAAAGACCGTTGGAGTTGGTGAAAGATGCAGTTGGAAATGAAAGCAAAGATAAGAGTTCAAGTTAGGAAGTAACTGGTAATCAAAGTAATAAATTTTCTTCTTTTCCTCTTACCAGTTTTGCTTTGATCCTGTTAGATTACTTTTTTCTATGGATGAAGTTATGCTCTGAGGGCATGATCTCTCAAACTGTTTTTATTCATTCATAAATCAATCATGACTATATTTCTGAAATCTTTTCCTCGCATGTTTAGTGTTTACAGTCTCATATCTGATTCAGTAAAATGAATATTGGATTAACGCTTGGCTTTGGGTCTTAATTTTATGTGCAGTTTGATGCATTGCAAATCTTTGATTTATGCATCATTTTATACTAACTAGAAAGTCTAAAATGATGAGATTATTGTCTAGTTTCAGAAACCCCAGTTCTAGTTGGTTAGTTTATGTTAGAAGATGGGGTTTGCTGTTTCCTTATGCTCTTGATCGATGTTCTTCGGTTTCATGTTTTTGCTTACCTCATCAAGTCAAAGCCACATCTATTCTGATTTGCCTCTTTTTATATAGAAGAAGTTAGAACACATCATATTCTTGTGTTAACACTGGTCTTTGATTATGCTCTTTGAATTAGGGACAGAATCTTAAGATCTTTATGAAAATTCTTGTACGGTGTTGTCTTGTCGTGTTGAGCTGAGCCTTCAATTGCTAGTGTTTGCTTCTGTTACTCTGAATTATATTTGGACAATCTCACTCTAATAAAAGTTTTTTAAATACTAGCAGAATTGTTAATTT
CDS Sequence
Protein Sequence