Information report for AT5G22880
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0005052 — plant callus — callo (Spanish, exact), portion of plant callus tissue (exact), 植物カルス (Japanese, exact), callus (broad)
Functional Keywords
Literature and News
- Split luciferase complementation assay to study protein-protein interactions in Arabidopsis protoplasts. DOI: 10.1111/j.1365-313X.2007.03214.x ; PMID: 17662028
- UBIQUITIN-SPECIFIC PROTEASE 26 is required for seed development and the repression of PHERES1 in Arabidopsis. DOI: 10.1534/genetics.108.091736 ; PMID: 18723879
- Histone H2B monoubiquitination in the chromatin of FLOWERING LOCUS C regulates flowering time in Arabidopsis. DOI: 10.1105/tpc.108.062760 ; PMID: 18849490
- Control of the transition to flowering by chromatin modifications. DOI: 10.1093/mp/ssp005 ; PMID: 19825638
- Overexpression of several Arabidopsis histone genes increases agrobacterium-mediated transformation and transgene expression in plants. DOI: 10.1105/tpc.109.070607 ; PMID: 19820187
- The role of the transcript elongation factors FACT and HUB1 in leaf growth and the induction of flowering. DOI: 10.4161/psb.5.6.11646 ; PMID: 20404555
- Proteomic analyses identify a diverse array of nuclear processes affected by small ubiquitin-like modifier conjugation in Arabidopsis. DOI: 10.1073/pnas.1004181107 ; PMID: 20813957
- Heterosis manifestation during early Arabidopsis seedling development is characterized by intermediate gene expression and enhanced metabolic activity in the hybrids. DOI: 10.1111/j.1365-313X.2012.05021.x ; PMID: 22487254
- A genome-wide transcriptome profiling reveals the early molecular events during callus initiation in Arabidopsis multiple organs. DOI: 10.1016/j.ygeno.2012.05.013 ; PMID: 22664253
- Histone H2B monoubiquitination facilitates the rapid modulation of gene expression during Arabidopsis photomorphogenesis. DOI: 10.1371/journal.pgen.1002825 ; PMID: 22829781
- Is HUB1 a hub for plant fitness? DOI: 10.4161/psb.22326 ; PMID: 23073007
- Global Regulation of Plant Immunity by Histone Lysine Methyl Transferases. DOI: 10.1105/tpc.16.00012 ; PMID: 27354553
- Activation of gene expression by histone deubiquitinase OTLD1. DOI: 10.1080/15592294.2017.1348446 ; PMID: 28703681
- BICELLULAR POLLEN 1 is a modulator of DNA replication and pollen development in Arabidopsis. DOI: 10.1111/nph.15610 ; PMID: 30484867
- Histone Deubiquitinase OTU1 Epigenetically Regulates DA1 and DA2, Which Control Arabidopsis Seed and Organ Size. DOI: 10.1016/j.isci.2020.100948 ; PMID: 32169818
- A unified phylogeny-based nomenclature for histone variants. DOI: 10.1186/1756-8935-5-7 ; PMID: 22650316
- Plant Histone HTB (H2B) Variants in Regulating Chromatin Structure and Function. DOI: 10.3390/plants9111435 ; PMID: 33113795
- Plant-specific HDT family histone deacetylases are nucleoplasmins. DOI: 10.1093/plcell/koac275 ; PMID: 36069647
- Arabidopsis LSH10 transcription factor and OTLD1 histone deubiquitinase interact and transcriptionally regulate the same target genes. DOI: 10.1038/s42003-023-04424-x ; PMID: 36650214
- The SMC5/6 complex recruits the PAF1 complex to facilitate DNA double-strand break repair in Arabidopsis. DOI: 10.15252/embj.2022112756 ; PMID: 36815434
- Proteome-wide lysine acetylation profiling to investigate the involvement of histone deacetylase HDA5 in the salt stress response of Arabidopsis leaves. DOI: 10.1111/tpj.16206 ; PMID: 36961081
- Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. DOI: 10.1091/mbc.e04-09-0791 ; PMID: 15496452
- Characterization of post-translational modifications of histone H2B-variants isolated from Arabidopsis thaliana. DOI: 10.1021/pr0702159 ; PMID: 17691833
Gene Resources
- UniProt: Q1H5F7
- EMBL: BT025507
- AlphaFoldDB: Q1H5F7
- EnsemblPlants: AT5G22880.1
- Gramene: AT5G22880.1
- KEGG: ath:AT5G22880
- Orthologous matrix: ELAKHAX
- ExpressionAtlas: AT5G22880
Sequences
cDNA Sequence
- >AT5G22880.1
CCACGTCACGCATCCGCGTTTCAGTATCTTAACTAATCAGATCTCTTCCTATTCTCTTATATAAACAAACACACAATTCTCGAAGATAACAGTATCAAATCAAAACCATCACAGCAAAAAAAACTCACTCCCTAGAAAAGTTTGAAAATGGCGAAGGCAGATAAGAAACCAGCGGAGAAGAAACCGGCAGAGAAAACTCCGGCAGCCGAACCAGCAGCAGCGGCAGAGAAGAAACCAAAAGCCGGAAAGAAACTCCCGAAGGAACCAGCCGGCGCCGGAGACAAGAAGAAGAAGAGATCAAAGAAGAACGTTGAGACATACAAGATCTACATCTTCAAGGTGTTGAAGCAAGTTCATCCAGATATCGGAATCTCCAGCAAAGCCATGGGAATCATGAACAGTTTCATCAATGATATCTTTGAGAAACTTGCTGGTGAGTCTTCGAAGCTTGCGAGGTACAACAAGAAGCCGACGATTACTTCTAGGGAGATTCAGACTGCGGTGAGACTTGTGTTGCCTGGAGAGTTGGCGAAACATGCTGTTTCTGAAGGGACTAAGGCGGTTACGAAGTTTACGAGTTCTTAGATTTGGAATGTGGTTTTGTAATGGAGGAGAAGTAGTAGTAGTAGTTGGAATGTGAAATAGGGTTTATGCTTTTGGGTATCTTTGAGGGTTATGTAATATGGGAATTAGGGTTTTAATTTATGGCACGGCTATGAAATCTACTTAATTTTCCAATGTTCGATTGCAATTTCATTGCTCAATTTCTCAAATCTGTTAATTTTGATTAGAATCTAAAGAGCTCCACTTTAACTGAGATAAAAAAAATTGAAACAGTGATTCTCAT
CDS Sequence
Protein Sequence