Information report for AT5G22570
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Functional Keywords
Literature and News
- The WRKY superfamily of plant transcription factors. DOI: 10.1016/s1360-1385(00)01600-9 ; PMID: 10785665
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Monitoring genome-wide changes in gene expression in response to endogenous cytokinin reveals targets in Arabidopsis thaliana. DOI: 10.1016/s0014-5793(03)01194-3 ; PMID: 14623097
- Genome-wide ORFeome cloning and analysis of Arabidopsis transcription factor genes. DOI: 10.1104/pp.104.042176 ; PMID: 15208423
- Genome-wide reprogramming of primary and secondary metabolism, protein synthesis, cellular growth processes, and the regulatory infrastructure of Arabidopsis in response to nitrogen. DOI: 10.1104/pp.104.047019 ; PMID: 15375205
- Genome-wide transcriptional analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human pathogen Escherichia coli O157:H7. DOI: 10.1111/j.1365-313X.2006.02725.x ; PMID: 16553894
- Gene expression programs during shoot, root, and callus development in Arabidopsis tissue culture. DOI: 10.1104/pp.106.081240 ; PMID: 16648215
- A high-performance, small-scale microarray for expression profiling of many samples in Arabidopsis-pathogen studies. DOI: 10.1111/j.1365-313X.2006.02972.x ; PMID: 17181774
- Phosphatidylinositol 4-kinase activation is an early response to salicylic acid in Arabidopsis suspension cells. DOI: 10.1104/pp.107.100842 ; PMID: 17496105
- A genomic approach to identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants. DOI: 10.1371/journal.ppat.0020123 ; PMID: 17096590
- Identification and characterization of COI1-dependent transcription factor genes involved in JA-mediated response to wounding in Arabidopsis plants. DOI: 10.1007/s00299-007-0410-z ; PMID: 17786451
- Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function. DOI: 10.1007/s11103-008-9353-1 ; PMID: 18523729
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Arabidopsis WRKY38 and WRKY62 transcription factors interact with histone deacetylase 19 in basal defense. DOI: 10.1105/tpc.107.055566 ; PMID: 18776063
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- PKS5, a SNF1-related kinase, interacts with and phosphorylates NPR1, and modulates expression of WRKY38 and WRKY62. DOI: 10.1016/S1673-8527(09)60054-0 ; PMID: 20621018
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- induced expression and histone modifications of WRKY genes. DOI: 10.1007/s12038-013-9407-7 ; PMID: 24499796
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- Establishment of Expression in the SHORTROOT-SCARECROW Transcriptional Cascade through Opposing Activities of Both Activators and Repressors. DOI: 10.1016/j.devcel.2016.09.031 ; PMID: 27923776
- Extracellular ATP Shapes a Defense-Related Transcriptome Both Independently and along with Other Defense Signaling Pathways. DOI: 10.1104/pp.18.01301 ; PMID: 30630869
- Arabidopsis heat shock transcription factor HSFA7b positively mediates salt stress tolerance by binding to an E-box-like motif to regulate gene expression. DOI: 10.1093/jxb/erz261 ; PMID: 31145794
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- A PXY-Mediated Transcriptional Network Integrates Signaling Mechanisms to Control Vascular Development in Arabidopsis. DOI: 10.1105/tpc.19.00562 ; PMID: 31806676
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- A genomic approach to identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants. DOI: 10.1371/journal.ppat.0020123 ; PMID: 17096590
Gene Resources
- UniProt: A0A178UNG1
- EMBL: LUHQ01000005
- AlphaFoldDB: A0A178UNG1
- EnsemblPlants: AT5G22570.1
- Gramene: AT5G22570.1
- KEGG: ath:AT5G22570
- Orthologous matrix: HHICKIN
- ExpressionAtlas: AT5G22570
- InterPro: IPR003657, IPR036576, IPR044810
- PANTHER: PTHR31282
- SUPFAM: SSF118290
- PROSITE: PS50811
- Gene3D: 2.20.25.80
- SWISS-MODEL: A0A178UNG1
Sequences
cDNA Sequence
- >AT5G22570.1
TTTTGTCTCTCTTTATTTAGATTCACGCATATAAGTCTAGCAGAGCACATGTCCTATATCGAAATTATAATTTATCATTGGCTTCTTAAAATATAACCTAGTGTATGTAAATTATATTTGGTAAACCCAAATTGGCAAAGTCATTTGGGAACGTGTATGTACGACTAGTCCTATAAATTCTGATCTCCCTATCCGTTCAAAAGTTTATAGCACAGAGAAGAGACTTGAGAAAAAGAAAACAAACAAGAAACACATACACACACACACAAGTTCACTATACTCTATGGAAATGAACTCCCCACACGAAAAGGCGGTGCAAGCTATCCGTTATGGCCATAGCTGCGCCATGCGGTTGAAGAGGCGGCTCAACCATCCAATGGCTGATGGTGGACCGCTTTCAAGTTATGATCTTGCTAAATCGATCGTTGAAAGTTTTTCCAATGCCATTTCAATCTTATCTGCTAAACCAGAAACCGAAGATGATCAGTTTTCTGATTTATCTTCTAGGGATTCTTCTCCTCCTCCACAGGGGAGCCCCTCCAAGAAAAGAAAGATTGATAGTACAAATTCAAGTGAGAATTGGAGGGACGATTCACCGGATCCGATTTACTACGACGGGTATCTTTGGAGGAAATATGGTCAAAAGAGTATAAAAAAATCTAATCACCAAAGGAGTTACTATAGATGTTCTTACAACAAAGATCATAACTGCGAAGCAAGAAAGCATGAACAAAAGATCAAAGACAATCCTCCGGTTTACCGAACCACTTACTTTGGCCACCACACTTGCAAAACCGAACATAATCTAGATGCCATTTTTATTGCCGGACAAGATCCCCTAGATGACTTTAAAAGTACCCAAATGATCCGATTCGGAAAAGATCAGGATCAGGAGAAGGAAAGCCGCTCGAACGGTTTCTCCTTATCGGTTAAGCATGAAGAAGATATCATCAAAGAGCAAGCTATAGATCAGTACCGTGAGATAACCAGTAATGACCAAGATTGTCAAGATGTTATAGAAGAATATCTATCATCACCATCAGGCTCTTATCCTCCTTCATCGTCATCTGGCAGTGAAAGTGCTGACTTTAATTCTGATTTGTTATTTGACAACCCAGACTCGTGGGATCGTTATGATCAGTTTTACTTTTGATTGCACTAGATTTTTCAGCTAAAACTATTTAATAATGTTTTCCTTTTTATGAGATTGTATATATTTGAGAATTGTGACTATTTAAGTATTTATGTTATTGATTAGATAATCCGAGAACAATATTTATATTCACCCCTAAGAGTTTATTTCCGG
CDS Sequence
Protein Sequence