AT5G20730

Information report for AT5G20730

Gene Details

Gene ID: AT5G20730
Gene Symbol: ARF7, BIP, IAA21, IAA23, IAA25, MSG1, NPH4, TIR5
Gene Name: AUXIN RESPONSE FACTOR 7, BIPOSTO, indole-3-acetic acid inducible 21, indole-3-acetic acid inducible 23, indole-3-acetic acid inducible 25, MASSUGU 1, NON-PHOTOTROPHIC HYPOCOTYL, TRANSPORT INHIBITOR RESPONSE 5
Description: Transcriptional factor B3 family protein / auxin-responsive factor AUX/IAA-like protein;(source:Araport11)
Description: Derives_from AT5G20730;(source:Araport11)
TAIR Accession: locus:2180469
Genome: Araport11_genome_release
Species: Arabidopsis thaliana

Functional Descriptions

PO:0000016 — lateral root primordium — portion of lateral root primordium tissue (exact), primordio de raíz lateral (Spanish, exact), 側根原基 (Japanese, exact)
PO:0009015 — portion of vascular tissue — porción de tejido vascular (Spanish, exact), vascular tissue (exact), 維管束細胞の一部 (Japanese, exact), vascular system (related)
PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)

GO:0005515 — enables — protein binding
GO:0009785 — acts upstream of or within — blue light signaling pathway
GO:0009733 — acts upstream of or within — response to auxin
GO:0006355 — involved in — regulation of DNA-templated transcription
GO:0045893 — acts upstream of or within — positive regulation of DNA-templated transcription
GO:0010311 — acts upstream of or within — lateral root formation
GO:0048366 — acts upstream of or within — leaf development
GO:0009638 — acts upstream of or within — phototropism
GO:0006355 — acts upstream of or within — regulation of DNA-templated transcription
GO:0009723 — acts upstream of or within — response to ethylene
GO:0005634 — located in — nucleus
GO:0009630 — acts upstream of or within — gravitropism
GO:0048527 — acts upstream of or within — lateral root development

CS24607 — impaired phototropic and gravitropic response in hypocotyls; reduced numbers of lateral roots; epinastic rosette leaves; reduced auxin sensitivity in hypocotyl growth
CS24625 — The double mutant exhibits much stronger auxin-related phenotypes than those of the single mutants. Adult double mutant plants have thin and short inflorescence stems, and their rosette leaves are small and epinastic. In addition, it has reduced numbers of inflorescence stems, suggesting enhanced apical dominance. By contrast, its flowers appear to be normal, and they fertilize normally.
CS24625 — The double mutant mutant displays agravitropic responses in both hypocotyls and roots. When seedlings are grown vertically under dark conditions, the regulation of growth orientation is disrupted in both hypocotyls and roots, with the hypocotyls occasionally growing downward and the roots upward. Also, the roots and hypocotyls of the double mutant show reduced gravitropic curvatures compared with the wild type when vertically dark-grown seedlings are reoriented by 90°.
CS24625 — The phenotype of the double mutant is most obvious at its seedling stage, with its most prominent phenotype being severely impaired lateral root formation. Its primary roots fail to produce lateral roots in 2-week-old seedlings. However, double mutant seedlings start to generate several lateral roots after ~2 weeks of growth, and their morphological appearance is normal.
CS24625 — The phototropic response toward blue light in hypocotyls of double mutant seedlings is disrupted.
CS24625 — nph4-1 arf19 double mutant; agravitropic response in both hypocotyls and roots; impaired phototropic response in hypocotyls; impaired lateral root formation; small plant size; small and epinastic rosette leaves; reduced auxin sensitivity
CS24626 — The double mutant exhibits much stronger auxin-related phenotypes than those of the single mutants. Adult double mutant plants have thin and short inflorescence stems, and their rosette leaves are small and epinastic. In addition, it has reduced numbers of inflorescence stems, suggesting enhanced apical dominance. By contrast, its flowers appear to be normal, and they fertilize normally.
CS24626 — The double mutant mutant displays agravitropic responses in both hypocotyls and roots. When seedlings are grown vertically under dark conditions, the regulation of growth orientation is disrupted in both hypocotyls and roots, with the hypocotyls occasionally growing downward and the roots upward. Also, the roots and hypocotyls of the double mutant show reduced gravitropic curvatures compared with the wild type when vertically dark-grown seedlings are reoriented by 90°.
CS24626 — The phenotype of the double mutant is most obvious at its seedling stage, with its most prominent phenotype being severely impaired lateral root formation. Its primary roots fail to produce lateral roots in 2-week-old seedlings. However, double mutant seedlings start to generate several lateral roots after ~2 weeks of growth, and their morphological appearance is normal.
CS24626 — The phototropic response toward blue light in hypocotyls of double mutant seedlings is disrupted.
CS24626 — nph4-1 arf19 double mutant; agravitropic response in both hypocotyls and roots; impaired phototropic response in hypocotyls; impaired lateral root formation; small plant size; small and epinastic rosette leaves; reduced auxin sensitivity
CS24627 — The double mutant exhibits much stronger auxin-related phenotypes than those of the single mutants. Adult double mutant plants have thin and short inflorescence stems, and their rosette leaves are small and epinastic. In addition, it has reduced numbers of inflorescence stems, suggesting enhanced apical dominance. By contrast, its flowers appear to be normal, and they fertilize normally.
CS24627 — The double mutant mutant displays agravitropic responses in both hypocotyls and roots. When seedlings are grown vertically under dark conditions, the regulation of growth orientation is disrupted in both hypocotyls and roots, with the hypocotyls occasionally growing downward and the roots upward. Also, the roots and hypocotyls of the double mutant show reduced gravitropic curvatures compared with the wild type when vertically dark-grown seedlings are reoriented by 90°.
CS24627 — The phenotype of the double mutant is most obvious at its seedling stage, with its most prominent phenotype being severely impaired lateral root formation. Its primary roots fail to produce lateral roots in 2-week-old seedlings. However, double mutant seedlings start to generate several lateral roots after ~2 weeks of growth, and their morphological appearance is normal.
CS24627 — The phototropic response toward blue light in hypocotyls of double mutant seedlings is disrupted.
CS24627 — msg1-2 arf19 double mutant; agravitropic response in both hypocotyls and roots; impaired phototropic response in hypocotyls; impaired lateral root formation; small plant size; small and epinastic rosette leaves; reduced auxin sensitivity
CS24628 — The double mutant exhibits much stronger auxin-related phenotypes than those of the single mutants. Adult double mutant plants have thin and short inflorescence stems, and their rosette leaves are small and epinastic. In addition, it has reduced numbers of inflorescence stems, suggesting enhanced apical dominance. By contrast, its flowers appear to be normal, and they fertilize normally.
CS24628 — The double mutant mutant displays agravitropic responses in both hypocotyls and roots. When seedlings are grown vertically under dark conditions, the regulation of growth orientation is disrupted in both hypocotyls and roots, with the hypocotyls occasionally growing downward and the roots upward. Also, the roots and hypocotyls of the double mutant show reduced gravitropic curvatures compared with the wild type when vertically dark-grown seedlings are reoriented by 90°.
CS24628 — The phenotype of the double mutant is most obvious at its seedling stage, with its most prominent phenotype being severely impaired lateral root formation. Its primary roots fail to produce lateral roots in 2-week-old seedlings. However, double mutant seedlings start to generate several lateral roots after ~2 weeks of growth, and their morphological appearance is normal.
CS24628 — The phototropic response toward blue light in hypocotyls of double mutant seedlings is disrupted.
CS24628 — msg1-2 arf19 double mutant; agravitropic response in both hypocotyls and roots; impaired phototropic response in hypocotyls; impaired lateral root formation; small plant size; small and epinastic rosette leaves; reduced auxin sensitivity
CS24629 — The double mutant exhibits much stronger auxin-related phenotypes than those of the single mutants. Adult double mutant plants have thin and short inflorescence stems, and their rosette leaves are small and epinastic. In addition, it has reduced numbers of inflorescence stems, suggesting enhanced apical dominance. By contrast, its flowers appear to be normal, and they fertilize normally.
CS24629 — The double mutant mutant displays agravitropic responses in both hypocotyls and roots. When seedlings are grown vertically under dark conditions, the regulation of growth orientation is disrupted in both hypocotyls and roots, with the hypocotyls occasionally growing downward and the roots upward. Also, the roots and hypocotyls of the double mutant show reduced gravitropic curvatures compared with the wild type when vertically dark-grown seedlings are reoriented by 90°.
CS24629 — The phenotype of the double mutant is most obvious at its seedling stage, with its most prominent phenotype being severely impaired lateral root formation. Its primary roots fail to produce lateral roots in 2-week-old seedlings. However, double mutant seedlings start to generate several lateral roots after ~2 weeks of growth, and their morphological appearance is normal.
CS24629 — The phototropic response toward blue light in hypocotyls of double mutant seedlings is disrupted.
CS24629 — arf7-1 arf19 double mutant; agravitropic response in both hypocotyls and roots; impaired phototropic response in hypocotyls; impaired lateral root formation; small plant size; small and epinastic rosette leaves; reduced auxin sensitivity
CS24630 — The double mutant exhibits much stronger auxin-related phenotypes than those of the single mutants. Adult double mutant plants have thin and short inflorescence stems, and their rosette leaves are small and epinastic. In addition, it has reduced numbers of inflorescence stems, suggesting enhanced apical dominance. By contrast, its flowers appear to be normal, and they fertilize normally.
CS24630 — The double mutant mutant displays agravitropic responses in both hypocotyls and roots. When seedlings are grown vertically under dark conditions, the regulation of growth orientation is disrupted in both hypocotyls and roots, with the hypocotyls occasionally growing downward and the roots upward. Also, the roots and hypocotyls of the double mutant show reduced gravitropic curvatures compared with the wild type when vertically dark-grown seedlings are reoriented by 90°.
CS24630 — The phenotype of the double mutant is most obvious at its seedling stage, with its most prominent phenotype being severely impaired lateral root formation. Its primary roots fail to produce lateral roots in 2-week-old seedlings. However, double mutant seedlings start to generate several lateral roots after ~2 weeks of growth, and their morphological appearance is normal.
CS24630 — The phototropic response toward blue light in hypocotyls of double mutant seedlings is disrupted.
CS24630 — arf7-1 arf19 double mutant; agravitropic response in both hypocotyls and roots; impaired phototropic response in hypocotyls; impaired lateral root formation; small plant size; small and epinastic rosette leaves; reduced auxin sensitivity
arf7-201 — Seedlings grown in the dark on sirtinol show long hypocotyls but no apical hook, have primary roots and are resistant to IAA and 2,4-D. In the dark, hypocotyls but not roots are resistant to 2,4-D. There is no obvious difference between wt and mutants grown on 2,4-D in the light.
arf7-201 arf19-101 — Dark grown seedlings on sirtinol have both long primary roots and long hypocotyls. More resistant to 2,4-D and IAA than single mutants in both light and dark. The ethylene resistant root phenotype of arf19-101 is enhanced by arf7-201.
dwf4-101 nph4-103 — Gravitropic curvature similar to that of wildtype (Col) when dark-grown. Over time however, the curvature becomes intermediate between that of the nph4 single mutant and wildtype.
dwf4-101 nph4-103 — In the presence of 1 microM brassinazole, an inhibitor of brassinolide biosynthesis, the mutant hypocotyls display the same gravitropic time course as that of wildtype.
dwf4-101 nph4-103 — Leaves and cotyledons are only weakly epinastic.
dwf4-101 nph4-103 — Mutant hypocotyls are more sensitive to IAA treatment (inhibition of growth) than those of wildtype.
dwf4-101 nph4-103 — Similar phototropic response of etiolated hypocotyls compared to that of wildtype.
msg1-1 — Hypocotyl growth resistant (but not root growth) to 2,4-D inhibition compared to wildtype.
msg1-1 — Mature mutant plants are largely wildtype in phenotype apart for the morphology of the rosette leaves.
msg1-1 — Root growth significantly reduced (about two-third of that of wildtype) when grown in white light.
msg1-1 — Rosette leaves are somewhat epinatic albeit less so than those of msg1-2.
msg1-1 — Slower gravitropic response than wildtype, although the final curvatures are comparable.
msg1-2 — Dramatically reduced phototropic response.
msg1-2 — Hypocotyl growth resistant (but not root growth) to 2,4-D inhibition compared to wildtype.
msg1-2 — Mature mutant plants are largely wildtype in phenotype apart for the morphology of the rosette leaves.
msg1-2 — Phenotype not described.
msg1-2 — Root growth significantly reduced (about two-third of that of wildtype) when grown in white light.
msg1-2 — Slower gravitropic response than wildtype, although the final curvatures are comparable.
msg1-2 — Strongly epinastic rosette leaves.
msg1-3 — About half of the rosette leaves are epinastic, the remaining half was hyponastic.
msg1-3 — Gravitropic response of dark-grown mutant hypocotyls is slower than that of wildtype (Col).
msg1-3 — Hypocotyl growth resistant (but not root growth) to 2,4-D inhibition compared to wildtype.
msg1-3 — In the presence of 1 microM brassinazole, an inhibitor of brassinolide biosynthesis, the mutant hypocotyls display the same gravitropic time course as that of wildtype.
msg1-3 — Mature mutant plants are largely wildtype in phenotype apart for the morphology of the rosette leaves.
msg1-3 — Mutant hypocotyls are more resistant to IAA treatment (inhibition of growth) than wildtype.
msg1-3 — Root growth significantly reduced (about two-third of that of wildtype) when grown in white light.
msg1-3 — Slower gravitropic response than wildtype, although the final curvatures are comparable.
msg1-3 — Slower phototropic response of etiolated hypocotyl compared to wildtype.
msg1-3 — When grown on 2,4-D-containing medium, the hyponastic rosette leaves become flat.
myb77-1/nph4-1 — Decreased density of lateral roots. Synergistic interaction.
nph4-1 — Dramatically reduced phototropic response.
nph4-1 — Mutant produces fewer lateral roots compared with the wild type.
nph4-1 — When seedlings are grown vertically under dark conditions, the hypocotyl growth orientation of mutant is significantly skewed compared with the wild type.
nph4-101 — Dramatically reduced phototropic response.
nph4-104 — Dramatically reduced phototropic response.
nph4-105 — Dramatically reduced phototropic response.
nph4-106 — Dramatically reduced phototropic response.
nph4-107 — Dramatically reduced phototropic response.
nph4-109 — Phenotype not described.
nph4-3 — Dramatically reduced phototropic response.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>AT5G20730.1
TTTAGCAGACCTTTTGGTAGTTGTCCTGGTCGCTGATCATCCCTTTCCGACAACTCTGTTGCTCTTTCTCTCACGTTTGAGTCTTAATCTTCGATTGTCCTTGGTCATCCTTAAGTTTTGTTTTTCTCTTTCGATTCATTTTCCAGATTTCTTTTTATAGAAACCCGTCTCTTTGATTTGATTCCCCCCAAGAAAGGAAAGCAAAACAAAGAAGAGCAGCTGAATCAAGTAACTTTGTGGGTGTTTTTGAATTATCTGACTCGAGATAAAGAGCTTCGTTAAAAACGGAATCTTTTTTAAGGTCGTATGCTTTGTTTGTCTCTCCGGAGATTCCGCGTGTGAAAAGTCGTGGTTTTTGATCTCTTTGAGATACTTAAAATTTCCGAGAAATTGGCGGCTCTGTCGGAGATAAAAAGCTGAGATCTTGGAGTTCCCCATTTCTGATTAACGATTCTCTCTGCTGTTACTTGAGCTAGGAAGCTATTAACAACTTGAGTGAAAGTTTAGGGCTTTTGATGAAGCTCTCACGCAAAGAGCTTAGCTTTGTATAAGCTCAGATTCAGATTATTTATTGGGTTTATTCTTCAGAGAAAGTAAAGTTGAGTGATCATGAAAGCTCCTTCATCAAATGGAGTTTCTCCTAATCCTGTTGAAGGAGAAAGGAGAAATATAAACTCAGAGCTATGGCACGCTTGTGCTGGGCCATTGATTTCGTTGCCTCCAGCAGGAAGTCTTGTTGTTTACTTCCCTCAAGGTCACAGTGAGCAAGTCGCGGCTTCAATGCAGAAGCAGACTGATTTCATACCAAGTTACCCGAATCTTCCTTCCAAGCTCATATGCATGCTCCACAATGTTACACTGAATGCTGATCCTGAGACGGATGAGGTCTATGCGCAGATGACTCTTCAGCCAGTAAACAAATATGACAGAGATGCATTGCTTGCTTCTGACATGGGTCTTAAGCTAAACAGACAACCTAATGAATTTTTCTGCAAAACCCTCACGGCGAGTGACACAAGTACTCACGGTGGATTTTCTGTACCCCGACGAGCTGCTGAGAAAATCTTTCCTGCTCTGGATTTCTCGATGCAACCACCTTGTCAGGAGCTTGTTGCTAAGGATATTCATGACAACACATGGACTTTCAGACATATTTATCGAGGTCAACCAAAAAGGCACTTGCTAACTACAGGCTGGAGTGTGTTTGTCAGCACGAAAAGGCTCTTTGCTGGAGACTCTGTTCTTTTTATAAGAGATGGAAAGGCGCAACTTCTGTTGGGGATAAGACGTGCAAATAGACAACAGCCTGCACTTTCTTCATCTGTAATATCAAGTGATAGCATGCACATCGGAGTTCTTGCAGCTGCAGCTCATGCTAATGCTAATAACAGTCCTTTCACCATTTTCTACAACCCGAGGTGGGCTGCTCCTGCTGAGTTTGTGGTTCCTTTAGCCAAGTATACCAAAGCGATGTACGCTCAAGTTTCCCTCGGTATGCGGTTTAGAATGATATTTGAGACTGAAGAATGTGGAGTTCGTCGGTATATGGGTACAGTTACCGGTATCAGTGATCTTGATCCAGTGAGATGGAAAAACTCTCAGTGGCGGAATCTTCAGATTGGATGGGATGAGTCAGCTGCTGGTGATAGGCCCAGTCGAGTTTCAGTTTGGGACATTGAACCGGTTTTAACTCCTTTCTACATATGTCCTCCTCCATTTTTCCGACCTCGCTTTTCTGGACAACCTGGAATGCCAGATGATGAGACTGACATGGAGTCTGCACTGAAGAGAGCAATGCCATGGCTTGATAATAGCTTAGAGATGAAAGACCCTTCGAGTACTATCTTTCCTGGTCTGAGTTTAGTTCAGTGGATGAATATGCAGCAGCAGAACGGCCAGCTACCCTCTGCTGCTGCACAGCCAGGTTTCTTCCCATCAATGCTTTCGCCAACCGCGGCGCTGCACAACAATCTTGGCGGCACTGATGATCCCTCCAAGTTACTGAGCTTTCAGACGCCGCACGGGGGGATTTCCTCCTCAAATCTCCAATTTAACAAACAGAATCAGCAAGCCCCAATGTCTCAGTTGCCTCAGCCACCAACTACGTTGTCCCAACAACAGCAGCTGCAGCAATTGTTGCACTCCTCTTTGAACCATCAACAACAGCAATCGCAGTCTCAACAACAGCAACAACAACAACAGTTGCTGCAGCAGCAACAACAATTGCAGTCTCAACAACACAGCAACAACAATCAATCGCAGTCTCAGCAACAACAACAATTGCTCCAGCAGCAACAACAACAACAACTGCAGCAACAACATCAACAACCGTTACAGCAACAGACTCAGCAGCAGCAGCTAAGAACACAGCCATTGCAATCTCACTCGCATCCACAGCCACAACAGTTACAACAACATAAGTTGCAGCAACTTCAGGTTCCACAGAATCAGCTTTACAATGGTCAACAAGCAGCGCAGCAGCATCAGTCGCAACAAGCATCTACACATCATTTGCAACCACAATTAGTTTCGGGATCAATGGCAAGCAGTGTCATCACGCCTCCGTCCAGCTCCCTTAATCAAAGCTTTCAACAGCAACAACAACAGTCTAAGCAACTTCAACAAGCACATCACCATTTAGGTGCTAGCACTAGCCAGAGTAGTGTAATTGAAACCAGCAAGTCTTCATCCAATCTGATGTCCGCACCGCCGCAAGAGACACAGTTTTCACGACAAGTAGAACAGCAGCAGCCTCCTGGTCTCAACGGGCAGAATCAGCAAACACTTTTGCAGCAGAAAGCTCACCAGGCACAGGCCCAACAGATATTCCAGCAGAGTCTCTTGGAACAGCCGCATATACAGTTTCAGCTGTTACAGAGATTACAACAGCAACAGCAGCAGCAATTTCTTTCGCCGCAGTCTCAGTTACCACACCATCAATTGCAAAGCCAGCAGTTGCAACAGCTGCCTACTCTCTCTCAAGGTCATCAGTTTCCGTCATCTTGCACTAACAATGGCTTATCGACGTTGCAACCACCTCAAATGCTGGTGAGCCGACCTCAGGAAAAACAAAACCCACCGGTTGGGGGAGGGGTCAAAGCTTATTCAGGCATCACAGATGGAGGAGATGCACCTTCCTCTTCAACGTCGCCTTCCACCAACAACTGTCAGATCTCTTCTTCAGGCTTTCTCAACAGAAGCCAAAGCGGGCCAGCGATCTTGATACCTGATGCAGCGATTGATATGTCTGGTAATCTTGTTCAGGATCTTTACAGCAAATCCGATATGCGGCTAAAACAAGAACTCGTGGGTCAGCAAAAGTCCAAAGCTAGTTTAACAGATCATCAACTAGAAGCATCTGCCTCTGGAACTTCTTACGGTTTAGATGGAGGCGAAAACAACAGACAACAAAATTTCTTGGCTCCAACTTTTGGCCTTGACGGTGATTCCAGGAACAGCTTGCTCGGTGGAGCTAATGTTGATAATGGCTTTGTGCCTGACACGCTACTCTCGAGGGGATATGACTCCCAGAAAGATCTTCAGAACATGCTTTCAAACTATGGAGGAGTGACAAATGACATTGGTACAGAGATGTCTACTTCAGCTGTAAGAACTCAATCTTTTGGTGTCCCCAATGTGCCCGCCATTTCGAACGATCTAGCTGTCAACGATGCTGGAGTTCTTGGTGGTGGATTGTGGCCAGCTCAGACTCAGCGAATGCGAACTTATACAAAGGTGCAAAAACGAGGCTCAGTGGGGAGATCAATAGACGTCAACCGTTACAGAGGTTACGATGAGCTGAGGCATGATCTAGCGCGCATGTTTGGGATCGAAGGACAGCTCGAAGATCCTCAAACATCTGACTGGAAACTTGTTTATGTCGATCATGAAAATGACATCCTCCTCGTCGGCGATGATCCATGGGAAGAATTCGTAAACTGTGTTCAGAGCATTAAGATCCTTTCATCAGCTGAGGTTCAGCAGATGAGCTTAGACGGGAACTTTGCCGGTGTACCAGTTACTAATCAAGCTTGTAGTGGCGGTGACAGTGGCAATGCTTGGAGAGGTCATTATGATGATAACTCAGCCACTTCGTTTAACCGGTGATGGCAGAAGAGTTCTCTCACAGACAAAGATTCTTTTTTCTTCGTTTTGTAATATAACTTCTCGTTGATAACATGTCTCAAGTTTCCACTGGGCACTGTAGAGCATTTACCTGTAAAATATCTTCCACTAAGTTTACACGGAGATTTTATTTGCTGTGAGTCACTGTTTCTACCAAGTTTAACTGATCAACTGAAACCGCTTGTAACCAAAAAGAGAAGGAAAAACATGAAATCA
>AT5G20730.2
TTTAGCAGACCTTTTGGTAGTTGTCCTGGTCGCTGATCATCCCTTTCCGACAACTCTGTTGCTCTTTCTCTCACGTTTGAGTCTTAATCTTCGATTGTCCTTGGTCATCCTTAAGTTTTGTTTTTCTCTTTCGATTCATTTTCCAGATTTCTTTTTATAGAAACCCGTCTCTTTGATTTGATTCCCCCCAAGAAAGGAAAGCAAAACAAAGAAGAGCAGCTGAATCAAGTAACTTTGTGGGTGTTTTTGAATTATCTGACTCGAGATAAAGAGCTTCGTTAAAAACGGAATCTTTTTTAAGGTCGTATGCTTTGTTTGTCTCTCCGGAGATTCCGCGTGTGAAAAGTCGTGGTTTTTGATCTCTTTGAGATACTTAAAATTTCCGAGAAATTGGCGGCTCTGTCGGAGATAAAAAGCTGAGATCTTGGAGTTCCCCATTTCTGATTAACGATTCTCTCTGCTGTTACTTGAGCTAGGAAGCTATTAACAACTTGAGTGAAAGTTTAGGGCTTTTGATGAAGCTCTCACGCAAAGAGCTTAGCTTTGTATAAGCTCAGATTCAGATTATTTATTGGGTTTATTCTTCAGAGAAAGTAAAGTTGAGTGATCATGAAAGCTCCTTCATCAAATGGAGTTTCTCCTAATCCTGTTGAAGGAGAAAGGAGAAATATAAACTCAGAGCTATGGCACGCTTGTGCTGGGCCATTGATTTCGTTGCCTCCAGCAGGAAGTCTTGTTGTTTACTTCCCTCAAGGTCACAGTGAGCAAGTCGCGGCTTCAATGCAGAAGCAGACTGATTTCATACCAAGTTACCCGAATCTTCCTTCCAAGCTCATATGCATGCTCCACAATGTTACACTGAATGCTGATCCTGAGACGGATGAGGTCTATGCGCAGATGACTCTTCAGCCAGTAAACAAATATGACAGAGATGCATTGCTTGCTTCTGACATGGGTCTTAAGCTAAACAGACAACCTAATGAATTTTTCTGCAAAACCCTCACGGCGAGTGACACAAGTACTCACGGTGGATTTTCTGTACCCCGACGAGCTGCTGAGAAAATCTTTCCTGCTCTGGATTTCTCGATGCAACCACCTTGTCAGGAGCTTGTTGCTAAGGATATTCATGACAACACATGGACTTTCAGACATATTTATCGAGGTCAACCAAAAAGGCACTTGCTAACTACAGGCTGGAGTGTGTTTGTCAGCACGAAAAGGCTCTTTGCTGGAGACTCTGTTCTTTTTATAAGAGATGGAAAGGCGCAACTTCTGTTGGGGATAAGACGTGCAAATAGACAACAGCCTGCACTTTCTTCATCTGTAATATCAAGTGATAGCATGCACATCGGAGTTCTTGCAGCTGCAGCTCATGCTAATGCTAATAACAGTCCTTTCACCATTTTCTACAACCCGAGGTGGGCTGCTCCTGCTGAGTTTGTGGTTCCTTTAGCCAAGTATACCAAAGCGATGTACGCTCAAGTTTCCCTCGGTATGCGGTTTAGAATGATATTTGAGACTGAAGAATGTGGAGTTCGTCGGTATATGGGTACAGTTACCGGTATCAGTGATCTTGATCCAGTGAGATGGAAAAACTCTCAGTGGCGGAATCTTCAGATTGGATGGGATGAGTCAGCTGCTGGTGATAGGCCCAGTCGAGTTTCAGTTTGGGACATTGAACCGGTTTTAACTCCTTTCTACATATGTCCTCCTCCATTTTTCCGACCTCGCTTTTCTGGACAACCTGGAATGCCAGATGATGAGACTGACATGGAGTCTGCACTGAAGAGAGCAATGCCATGGCTTGATAATAGCTTAGAGATGAAAGACCCTTCGAGTACTATCTTTCCTGGTCTGAGTTTAGTTCAGTGGATGAATATGCAGCAGCAGAACGGCCAGCTACCCTCTGCTGCTGCACAGCCAGGTTTCTTCCCATCAATGCTTTCGCCAACCGCGGCGCTGCACAACAATCTTGGCGGCACTGATGATCCCTCCAAGTTACTGAGCTTTCAGACGCCGCACGGGGGGATTTCCTCCTCAAATCTCCAATTTAACAAACAGAATCAGCAAGCCCCAATGTCTCAGTTGCCTCAGCCACCAACTACGTTGTCCCAACAACAGCAGCTGCAGCAATTGTTGCACTCCTCTTTGAACCATCAACAACAGCAATCGCAGTCTCAACAACAGCAACAACAACAACAGTTGCTGCAGCAGCAACAACAATTGCAGTCTCAACAACACAGCAACAACAATCAATCGCAGTCTCAGCAACAACAACAATTGCTCCAGCAGCAACAACAACAACAACTGCAGCAACAACATCAACAACCGTTACAGCAACAGACTCAGCAGCAGCAGCTAAGAACACAGCCATTGCAATCTCACTCGCATCCACAGCCACAACAGTTACAACAACATAAGTTGCAGCAACTTCAGGTTCCACAGAATCAGCTTTACAATGGTCAACAAGCAGCGCAGCAGCATCAGTCGCAACAAGCATCTACACATCATTTGCAACCACAATTAGTTTCGGGATCAATGGCAAGCAGTGTCATCACGCCTCCGTCCAGCTCCCTTAATCAAAGCTTTCAACAGCAACAACAACAGTCTAAGCAACTTCAACAAGCACATCACCATTTAGGTGCTAGCACTAGCCAGAGTAGTGTAATTGAAACCAGCAAGTCTTCATCCAATCTGATGTCCGCACCGCCGCAAGAGACACAGTTTTCACGACAAGTAGAACAGCAGCAGCCTCCTGGTCTCAACGGGCAGAATCAGCAAACACTTTTGCAGCAGAAAGCTCACCAGGCACAGGCCCAACAGATATTCCAGCAGAGTCTCTTGGAACAGCCGCATATACAGTTTCAGCTGTTACAGAGATTACAACAGCAACAGCAGCAGCAATTTCTTTCGCCGCAGTCTCAGTTACCACACCATCAATTGCAAAGCCAGCAGTTGCAACAGCTGCCTACTCTCTCTCAAGGTCATCAGTTTCCGTCATCTTGCACTAACAATGGCTTATCGACGTTGCAACCACCTCAAATGCTGGTGAGCCGACCTCAGGAAAAACAAAACCCACCGGTTGGGGGAGGGGTCAAAGCTTATTCAGGCATCACAGATGGAGGAGATGCACCTTCCTCTTCAACGTCGCCTTCCACCAACAACTGTCAGATCTCTTCTTCAGGCTTTCTCAACAGAAGCCAAAGCGGGCCAGCGATCTTGATACCTGATGCAGCGATTGATATGTCTGGTAATCTTGTTCAGGATCTTTACAGCAAATCCGATATGCGGCTAAAACAAGAACTCGTGGGTCAGCAAAAGTCCAAAGCTAGTTTAACAGATCATCAACTAGAAGCATCTGCCTCTGGAACTTCTTACGGTTTAGATGGAGGCGAAAACAACAGACAACAAAATTTCTTGGCTCCAACTTTTGGCCTTGACGGTGATTCCAGGAACAGCTTGCTCGGTGGAGCTAATGTTGATAATGGCTTTGTGCCTGACACGCTACTCTCGAGGGGATATGACTCCCAGAAAGATCTTCAGAACATGCTTTCAAACTATGGAGGAGTGACAAATGACATTGGTACAGAGATGTCTACTTCAGCTGTAAGAACTCAATCTTTTGGTGTCCCCAATGTGCCCGCCATTTCGAACGATCTAGCTGTCAACGATGCTGGAGTTCTTGGTGGTGGATTGTGGCCAGCTCAGACTCAGCGAATGCGAACTTATACAAAGGTGCAAAAACGAGGCTCAGTGGGGAGATCAATAGACGTCAACCGTTACAGAGGTTACGATGAGCTGAGGCATGATCTAGCGCGCATGTTTGGGATCGAAGGACAGCTCGAAGATCCTCAAACATCTGACTGGAAACTTGTTTATGTCGATCATGAAAATGACATCCTCCTCGTCGGCGATGATCCATGGGAAGAATTCGTAAACTGTGTTCAGAGCATTAAGATCCTTTCATCAGCTGAGGTTCAGCAGATGAGCTTAGACGGGAACTTTGCCGGTGTACCAGTTACTAATCAAGCTTGTAGTGGCGGTGACAGTGGCAATGCTTGGAGAGGTCATTATGATGATAACTCAGCCACTTCGTTTAACCGGTGATGGCAGAAGAGTTCTCTCACAGACAAAGATTCTTTTTTCTTCGTTTTGTAATATAACTTCTCGTTGATAACATGTCTCAAGTTTCCACTGGGCACTGTAGAGCATTTACCTGTAAAATATCTTCCACTAAGTTTACACGGAGATTTTATTTGCTGTGAGTCACTGTTTCTACCAAGTTTAACTGATCAACTGAAACCGCTTGTAACCAAAAAGAGAAGGAAAAACATGAAATCA
>AT5G20730.3
TTTAGCAGACCTTTTGGTAGTTGTCCTGGTCGCTGATCATCCCTTTCCGACAACTCTGTTGCTCTTTCTCTCACGTTTGAGTCTTAATCTTCGATTGTCCTTGGTCATCCTTAAGTTTTGTTTTTCTCTTTCGATTCATTTTCCAGATTTCTTTTTATAGAAACCCGTCTCTTTGATTTGATTCCCCCCAAGAAAGGAAAGCAAAACAAAGAAGAGCAGCTGAATCAAGTAACTTTGTGGGTGTTTTTGAATTATCTGACTCGAGATAAAGAGCTTCGTTAAAAACGGAATCTTTTTTAAGGTCGTATGCTTTGTTTGTCTCTCCGGAGATTCCGCGTGTGAAAAGTCGTGGTTTTTGATCTCTTTGAGATACTTAAAATTTCCGAGAAATTGGCGGCTCTGTCGGAGATAAAAAGCTGAGATCTTGGAGTTCCCCATTTCTGATTAACGATTCTCTCTGCTGTTACTTGAGCTAGGAAGCTATTAACAACTTGAGTGAAAGTTTAGGGCTTTTGATGAAGCTCTCACGCAAAGAGCTTAGCTTTGTATAAGCTCAGATTCAGATTATTTATTGGGTTTATTCTTCAGAGAAAGTAAAGTTGAGTGATCATGAAAGCTCCTTCATCAAATGGAGTTTCTCCTAATCCTGTTGAAGGAGAAAGGAGAAATATAAACTCAGAGCTATGGCACGCTTGTGCTGGGCCATTGATTTCGTTGCCTCCAGCAGGAAGTCTTGTTGTTTACTTCCCTCAAGGTCACAGTGAGCAAGTCGCGGCTTCAATGCAGAAGCAGACTGATTTCATACCAAGTTACCCGAATCTTCCTTCCAAGCTCATATGCATGCTCCACAATGTTACACTGAATGCTGATCCTGAGACGGATGAGGTCTATGCGCAGATGACTCTTCAGCCAGTAAACAAATATGACAGAGATGCATTGCTTGCTTCTGACATGGGTCTTAAGCTAAACAGACAACCTAATGAATTTTTCTGCAAAACCCTCACGGCGAGTGACACAAGTACTCACGGTGGATTTTCTGTACCCCGACGAGCTGCTGAGAAAATCTTTCCTGCTCTGGATTTCTCGATGCAACCACCTTGTCAGGAGCTTGTTGCTAAGGATATTCATGACAACACATGGACTTTCAGACATATTTATCGAGGTCAACCAAAAAGGCACTTGCTAACTACAGGCTGGAGTGTGTTTGTCAGCACGAAAAGGCTCTTTGCTGGAGACTCTGTTCTTTTTATAAGAGATGGAAAGGCGCAACTTCTGTTGGGGATAAGACGTGCAAATAGACAACAGCCTGCACTTTCTTCATCTGTAATATCAAGTGATAGCATGCACATCGGAGTTCTTGCAGCTGCAGCTCATGCTAATGCTAATAACAGTCCTTTCACCATTTTCTACAACCCGAGGTGGGCTGCTCCTGCTGAGTTTGTGGTTCCTTTAGCCAAGTATACCAAAGCGATGTACGCTCAAGTTTCCCTCGGTATGCGGTTTAGAATGATATTTGAGACTGAAGAATGTGGAGTTCGTCGGTATATGGGTACAGTTACCGGTATCAGTGATCTTGATCCAGTGAGATGGAAAAACTCTCAGTGGCGGAATCTTCAGATTGGATGGGATGAGTCAGCTGCTGGTGATAGGCCCAGTCGAGTTTCAGTTTGGGACATTGAACCGGTTTTAACTCCTTTCTACATATGTCCTCCTCCATTTTTCCGACCTCGCTTTTCTGGACAACCTGGAATGCCAGATGATGAGACTGACATGGAGTCTGCACTGAAGAGAGCAATGCCATGGCTTGATAATAGCTTAGAGATGAAAGACCCTTCGAGTACTATCTTTCCTGGTCTGAGTTTAGTTCAGTGGATGAATATGCAGCAGCAGAACGGCCAGCTACCCTCTGCTGCTGCACAGCCAGGTTTCTTCCCATCAATGCTTTCGCCAACCGCGGCGCTGCACAACAATCTTGGCGGCACTGATGATCCCTCCAAGTTACTGAGCTTTCAGACGCCGCACGGGGGGATTTCCTCCTCAAATCTCCAATTTAACAAACAGAATCAGCAAGCCCCAATGTCTCAGTTGCCTCAGCCACCAACTACGTTGTCCCAACAACAGCAGCTGCAGCAATTGTTGCACTCCTCTTTGAACCATCAACAACAGCAATCGCAGTCTCAACAACAGCAACAACAACAACAGTTGCTGCAGCAGCAACAACAATTGCAGTCTCAACAACACAGCAACAACAATCAATCGCAGTCTCAGCAACAACAACAATTGCTCCAGCAGCAACAACAACAACAACTGCAGCAACAACATCAACAACCGTTACAGCAACAGACTCAGCAGCAGCAGCTAAGAACACAGCCATTGCAATCTCACTCGCATCCACAGCCACAACAGTTACAACAACATAAGTTGCAGCAACTTCAGGTTCCACAGAATCAGCTTTACAATGGTCAACAAGCAGCGCAGCAGCATCAGTCGCAACAAGCATCTACACATCATTTGCAACCACAATTAGTTTCGGGATCAATGGCAAGCAGTGTCATCACGCCTCCGTCCAGCTCCCTTAATCAAAGCTTTCAACAGCAACAACAACAGTCTAAGCAACTTCAACAAGCACATCACCATTTAGGTGCTAGCACTAGCCAGAGTAGTGTAATTGAAACCAGCAAGTCTTCATCCAATCTGATGTCCGCACCGCCGCAAGAGACACAGTTTTCACGACAAGTAGAACAGCAGCAGCCTCCTGGTCTCAACGGGCAGAATCAGCAAACACTTTTGCAGCAGAAAGCTCACCAGGCACAGGCCCAACAGATATTCCAGCAGAGTCTCTTGGAACAGCCGCATATACAGTTTCAGCTGTTACAGAGATTACAACAGCAACAGCAGCAGCAATTTCTTTCGCCGCAGTCTCAGTTACCACACCATCAATTGCAAAGCCAGCAGTTGCAACAGCTGCCTACTCTCTCTCAAGGTCATCAGTTTCCGTCATCTTGCACTAACAATGGCTTATCGACGTTGCAACCACCTCAAATGCTGGTGAGCCGACCTCAGGAAAAACAAAACCCACCGGTTGGGGGAGGGGTCAAAGCTTATTCAGGCATCACAGATGGAGGAGATGCACCTTCCTCTTCAACGTCGCCTTCCACCAACAACTGTCAGATCTCTTCTTCAGGCTTTCTCAACAGAAGCCAAAGCGGGCCAGCGATCTTGATACCTGATGCAGCGATTGATATGTCTGGTAATCTTGTTCAGGATCTTTACAGCAAATCCGATATGCGGCTAAAACAAGAACTCGTGGGTCAGCAAAAGTCCAAAGCTAGTTTAACAGATCATCAACTAGAAGCATCTGCCTCTGGAACTTCTTACGGTTTAGATGGAGGCGAAAACAACAGACAACAAAATTTCTTGGCTCCAACTTTTGGCCTTGACGGTGATTCCAGGAACAGCTTGCTCGGTGGAGCTAATGTTGATAATGGCTTTGTGCCTGACACGCTACTCTCGAGGGGATATGACTCCCAGAAAGATCTTCAGAACATGCTTTCAAACTATGGAGGAGTGACAAATGACATTGGTACAGAGATGTCTACTTCAGCTGTAAGAACTCAATCTTTTGGTGTCCCCAATGTGCCCGCCATTTCGAACGATCTAGCTGTCAACGATGCTGGAGTTCTTGGTGGTGGATTGTGGCCAGCTCAGACTCAGCGAATGCGAACTTATACAAAGGTGCAAAAACGAGGCTCAGTGGGGAGATCAATAGACGTCAACCGTTACAGAGGTTACGATGAGCTGAGGCATGATCTAGCGCGCATGTTTGGGATCGAAGGACAGCTCGAAGATCCTCAAACATCTGACTGGAAACTTGTTTATGTCGATCATGAAAATGACATCCTCCTCGTCGGCGATGATCCATGGGAAGAATTCGTAAACTGTGTTCAGAGCATTAAGATCCTTTCATCAGCTGAGGTTCAGCAGATGAGCTTAGACGGGAACTTTGCCGGTGTACCAGTTACTAATCAAGCTTGTAGTGGCGGTGACAGTGGCAATGCTTGGAGAGGTCATTATGATGATAACTCAGCCACTTCGTTTAACCGGTGATGGCAGAAGAGTTCTCTCACAGACAAAGATTCTTTTTTCTTCGTTTTGTAATATAACTTCTCGTTGATAACATGTCTCAAGTTTCCACTGGGCACTGTAGAGCATTTACCTGTAAAATATCTTCCACTAAGTTTACACGGAGATTTTATTTGCTGTGAGTCACTGTTTCTACCAAGTTTAACTGATCAACTGAAACCGCTTGTAACCAAAAAGAGAAGGAAAAACATGAAATCA

CDS Sequence

Protein Sequence