Gene Details:
- Gene ID: AT5G20650
- Gene Symbol: AtCOPT5, COPT5
- Gene Name: copper transporter 5
- Description: copper transporter 5;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000014 — rosette leaf — hoja en roseta (Spanish, exact), ロゼット葉 (Japanese, exact)
- PO:0009001 — fruit — frucht (exact, German), fruto (exact, Spanish), 果実 (exact, Japanese), coenocarp (narrow), syncarp (narrow), aggregate fruit (broad), compound fruit (broad), dehiscent fruit (broad), diaspore (broad), indehiscent fruit (broad), multiple fruit (broad), propagule (broad)
- PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
Function-related keywords:
- root , rosette leaf , fruit , root , stem
Literature:
- Identification of a copper transporter family in Arabidopsis thaliana. DOI: 10.1023/a:1022345507112 ; PMID: 12650623
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Quantitative trait locus mapping for seed mineral concentrations in two Arabidopsis thaliana recombinant inbred populations. DOI: 10.1111/j.1469-8137.2008.02544.x ; PMID: 18631293
- In planta changes in protein phosphorylation induced by the plant hormone abscisic acid. DOI: 10.1073/pnas.1007879107 ; PMID: 20733066
- The Arabidopsis COPT6 transport protein functions in copper distribution under copper-deficient conditions. DOI: 10.1093/pcp/pct088 ; PMID: 23766354
- Copper uptake mechanism of Arabidopsis thaliana high-affinity COPT transporters. DOI: 10.1007/s00709-018-1286-1 ; PMID: 30043153
- Copper transporter COPT5 participates in the crosstalk between vacuolar copper and iron pools mobilisation. DOI: 10.1038/s41598-018-38005-4 ; PMID: 30874615
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
Sequences:
cDNA Sequence
- >AT5G20650.1
GCCCACGAAGAAACGTATCTTCTAATCAATAATTCAACAAACCAAACCTCTTCCCAATCCCAACAGCTTCATCGTTTTATCTTCCAATCAAAGCAGCTCAAATCAAGCTCGCAAAGATGATGCACATGACCTTCTACTGGGGAATCAAAGCCACAATTCTCTTCGATTTCTGGAAAACTGACTCATGGCTTAGTTACATCCTCACTTTAATCGCTTGCTTCGTCTTCTCCGCTTTCTATCAATACCTCGAGAATCGCCGCATCCAATTCAAATCCCTTTCTTCCTCCCGTCGTGCTCCTCCACCGCCTCGCTCTTCCTCCGGCGTCTCCGCGCCTCTTATCCCTAAATCCGGTACCAGATCCGCCGCTAAAGCTGCTTCGGTTCTTCTTTTCGGCGTCAACGCAGCGATCGGTTACTTGCTGATGCTTGCAGCTATGTCTTTCAACGGAGGTGTTTTCATCGCGATTGTCGTCGGATTAACCGCCGGATACGCTGTTTTTAGATCTGATGACGGCGGTGCTGATACCGCCACGGATGATCCATGTCCATGTGCTTGATAATGATTGATAATAAAATCAAAATCGGAAAAATCTCAAAAAAGGTGTGTTTGATAATTGATGTTTGTATTGTTGTTTGTTTCTGTATGATTAGTTGCTTTGTAACAAAATAATCCAATCTAAATGTGTTTCTTGAGTATATGCAAATCTGAATTCTTATGATTTAGCCAGAATTCTTCAGCT
CDS Sequence
Protein Sequence