Information report for AT5G20630
Gene Details
|
|
Functional Descriptions
Functional Keywords
Literature and News
- Arabidopsis thaliana germin-like proteins: common and specific features point to a variety of functions. DOI: 10.1007/s004250000277 ; PMID: 10987552
- Arabidopsis thaliana contains a large family of germin-like proteins: characterization of cDNA and genomic sequences encoding 12 unique family members. DOI: 10.1023/a:1006038117130 ; PMID: 9869400
- cDNA sequence, genomic organization and differential expression of three Arabidopsis genes for germin/oxalate oxidase-like proteins. DOI: 10.1023/a:1005833028582 ; PMID: 9349269
- Analysis of the Arabidopsis nuclear proteome and its response to cold stress. DOI: 10.1046/j.1365-313x.2003.01907.x ; PMID: 14617066
- Target proteins of the cytosolic thioredoxins in Arabidopsis thaliana. DOI: 10.1093/pcp/pch019 ; PMID: 14749482
- Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. DOI: 10.1105/tpc.104.022699 ; PMID: 15319476
- Genes commonly regulated by water-deficit stress in Arabidopsis thaliana. DOI: 10.1093/jxb/erh270 ; PMID: 15448178
- The potassium-dependent transcriptome of Arabidopsis reveals a prominent role of jasmonic acid in nutrient signaling. DOI: 10.1104/pp.104.046482 ; PMID: 15347784
- Transcript profiling in Arabidopsis reveals complex responses to global inhibition of DNA methylation and histone deacetylation. DOI: 10.1074/jbc.M409053200 ; PMID: 15516340
- Proteomic analysis of secreted proteins from Arabidopsis thaliana seedlings: improved recovery following removal of phenolic compounds. DOI: 10.1016/j.phytochem.2004.12.013 ; PMID: 15694452
- Microarray analysis of genes that respond to gamma-irradiation in Arabidopsis. DOI: 10.1021/jf0486895 ; PMID: 15713015
- Co-immunoprecipitation of Hsp101 with cytosolic Hsc70. DOI: 10.1016/j.plaphy.2004.10.006 ; PMID: 15763661
- Cell wall proteins in apoplastic fluids of Arabidopsis thaliana rosettes: identification by mass spectrometry and bioinformatics. DOI: 10.1002/pmic.200400882 ; PMID: 15593128
- Identification of plant glutaredoxin targets. DOI: 10.1089/ars.2005.7.919 ; PMID: 15998247
- Proteomic analysis of different mutant genotypes of Arabidopsis led to the identification of 11 proteins correlating with adventitious root development. DOI: 10.1104/pp.105.067868 ; PMID: 16377752
- Transcriptional profiling implicates novel interactions between abiotic stress and hormonal responses in Thellungiella, a close relative of Arabidopsis. DOI: 10.1104/pp.105.070508 ; PMID: 16500996
- Oviposition by pierid butterflies triggers defense responses in Arabidopsis. DOI: 10.1104/pp.106.090837 ; PMID: 17142483
- Genotypic variation in genome-wide transcription profiles induced by insect feeding: Brassica oleracea–Pieris rapae interactions. DOI: 10.1186/1471-2164-8-239 ; PMID: 17640338
- Alternative and effective proteomic analysis in Arabidopsis. DOI: 10.1002/pmic.200700346 ; PMID: 17828791
- Core genome responses involved in acclimation to high temperature. DOI: 10.1104/pp.107.112060 ; PMID: 18055584
- Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation. DOI: 10.1104/pp.107.111286 ; PMID: 18218973
- Proteomic analysis of S-nitrosylated proteins in Arabidopsis thaliana undergoing hypersensitive response. DOI: 10.1002/pmic.200700536 ; PMID: 18297659
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Binding properties of the N-acetylglucosamine and high-mannose N-glycan PP2-A1 phloem lectin in Arabidopsis. DOI: 10.1104/pp.110.153882 ; PMID: 20442276
- Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying and up-regulation. DOI: 10.1093/jxb/ert227 ; PMID: 24064926
- PAWH1 and PAWH2 are plant-specific components of an Arabidopsis endoplasmic reticulum-associated degradation complex. DOI: 10.1038/s41467-019-11480-7 ; PMID: 31375683
- Analysis of the Arabidopsis nuclear proteome and its response to cold stress. DOI: 10.1046/j.1365-313x.2003.01907.x ; PMID: 14617066
- Cell wall proteins in apoplastic fluids of Arabidopsis thaliana rosettes: identification by mass spectrometry and bioinformatics. DOI: 10.1002/pmic.200400882 ; PMID: 15593128
- Proteomic analysis of different mutant genotypes of Arabidopsis led to the identification of 11 proteins correlating with adventitious root development. DOI: 10.1104/pp.105.067868 ; PMID: 16377752
- A sub-proteome of Arabidopsis thaliana mature stems trapped on Concanavalin A is enriched in cell wall glycoside hydrolases. DOI: 10.1093/jxb/erm082 ; PMID: 17526915
- Proteomic analysis of S-nitrosylated proteins in Arabidopsis thaliana undergoing hypersensitive response. DOI: 10.1002/pmic.200700536 ; PMID: 18297659
- Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. DOI: 10.1016/j.phytochem.2008.04.007 ; PMID: 18538804
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A5S9Y5Y3
- EMBL: CACRSJ010000110, CACSHJ010000096, LR881470
- AlphaFoldDB: A0A5S9Y5Y3
- EnsemblPlants: AT5G20630.1
- Gramene: AT5G20630.1
- KEGG: ath:AT5G20630
- Orthologous matrix: VQGTICA
- ExpressionAtlas: AT5G20630
- InterPro: IPR001929, IPR006045, IPR011051
- PANTHER: PTHR31238
- SUPFAM: SSF51182
- PROSITE: PS00725
- Gene3D: 2.60.120.10
- OrthoDB: A0A5S9Y5Y3
- SWISS-MODEL: A0A5S9Y5Y3
- Conserved Domain Database: cd02241
Sequences
cDNA Sequence
- >AT5G20630.1
CTCAGTCTCTATATAAACCAGACTGCCTCTCTTTCTGCCTCATAACTTCAACAAAAGCTCTTATCTATAAAACATTCTAAAGAAAAATGAAGATGATAATCCAAATTTTCTTCATCATCTCCCTCATTTCAACCATCTCTTTTGCCTCTGTTCAAGACTTTTGTGTAGCTGACCCAAAGGGTCCTCAAAGCCCATCAGGTTACTCTTGCAAGAACCCTGACCAAGTCACCGAAAATGACTTTGCATTTACCGGCCTCGGCACAGCTGGAAACACTTCCAACATCATTAAAGCCGCAGTGACTCCAGCCTTTGCTCCTGCTTACGCAGGCATCAATGGCCTTGGCGTATCTCTGGCTCGTCTTGACTTAGCCGGTGGTGGTGTCATCCCTCTCCACACTCATCCTGGTGCTTCTGAGGTCCTTGTAGTCATTCAAGGCACCATTTGCGCCGGATTTATCTCCTCCGCCAACAAAGTTTACTTGAAGACTCTCAACAGAGGAGATTCTATGGTGTTTCCTCAAGGACTTCTTCATTTTCAGCTAAACTCTGGGAAAGGCCCTGCCTTGGCCTTTGTCGCATTCGGAAGCTCCTCCCCAGGGCTCCAAATTCTACCATTTGCTCTGTTTGCAAACGATTTGCCTTCAGAACTTGTTGAAGCCACAACGTTCCTTAGCGATGCAGAAGTTAAGAAGCTTAAGGGTGTGCTTGGGGGAACTAATTAAGCTTCTCTTAGTTTCATTGTTCATTTTTTTAAAAATGTGGTTGTGCGTTTTGTTATTTCGAGTTCCTTTAGCATTTTGAGTTTGTTTCTTCTAATGATTTGGTTTTTCTTTATGAGTTGTTATTGTTCTCAATGTTTCATTTTATAGTCTCTTTGGCTTCAAATTGTAATAACTAATAAGCATTATATTGCAGATTTCTAAGTAGCTTGTCAACTATATCTCGACATTTGCACTAATAAGCAACTATTTAGCCGATGTTCAAAAAAATTTAAAATAAATAATGTTT
CDS Sequence
Protein Sequence