Gene Details:
- Gene ID: AT5G20290
- Gene Symbol: eS8z
- Gene Name: Ribosomal Protein eS8z
- Description: Ribosomal protein S8e family protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Function-related keywords:
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- The Arabidopsis co-expression tool (ACT): a WWW-based tool and database for microarray-based gene expression analysis. DOI: 10.1111/j.1365-313X.2006.02681.x ; PMID: 16623895
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night. DOI: 10.1371/journal.pone.0029307 ; PMID: 22195043
- A proteomics approach identifies novel proteins involved in gravitropic signal transduction. DOI: 10.3732/ajb.1200339 ; PMID: 23281391
- Arabidopsis thaliana MSI4/FVE associates with members of a novel family of plant specific PWWP/RRM domain proteins. DOI: 10.1007/s11103-014-0280-z ; PMID: 25600937
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. DOI: 10.1091/mbc.e04-09-0791 ; PMID: 15496452
- Proteomic characterization of evolutionarily conserved and variable proteins of Arabidopsis cytosolic ribosomes. DOI: 10.1104/pp.104.053637 ; PMID: 15734919
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
Sequences:
cDNA Sequence
- >AT5G20290.1
TTTATACTCCCTATATATTTATATTTAAGCTCTTCGTTCACTCCTCTCAACTCCGCGCAGCTAAACTTTATTGGAGAAACCCTAATCGGCGACAATGGGTATTTCTCGTGACTCTATCCACAAGAGGCGTGCCACTGGAGGCAAGCAGAAGCAATGGAGGAAGAAGCGAAAGTATGAGATGGGAAGGCAGCCAGCCAACACCAAGCTCTCAAGCAACAAGACGGTCAGAAGAATAAGAGTTCGTGGTGGAAATGTTAAGTGGCGTGCGTTGAGGCTCGATACTGGTAACTACTCGTGGGGAAGTGAAGCAACTACCCGCAAGACCAGAGTCCTTGATGTGGTCTACAATGCCTCCAACAATGAGCTTGTACGTACTAAGACACTTGTCAAGAGTGCTATTGTTCAGGTTGATGCTGCTCCGTTCAAGCAGTGGTACCTCTCGCACTATGGTGTTGAGCTTGGGCGCAAGAAGAAGAGTGCTTCTTCCACCAAGAAGGACGGAGAGGAAGGTGAAGAGGCAGCTGTTGCAGCTCCTGAGGAGGTCAAGAAGAGCAACCACCTCCTGAGAAAGATTGCAAGCCGTCAAGAGGGTCGCAGTCTTGATTCACACATTGAGGACCAATTTGCAAGTGGACGTTTGTTGGCTTGTATCTCTTCAAGGCCTGGCCAGTGCGGGCGTGCTGATGGATACATCTTGGAAGGTAAAGAGTTGGAGTTCTACATGAAGAAGATCCAGAAGAAGAAGGGCAAGGGTGCTGCTTAGAGTCTCTTCTTATCTGCCTTGAGCTTTTGTCTTACAACATGTTTTGAGTTTTCAGTTTCAATTGTCTGAGAAACTATGTTTTTGGATTAGCTTGTGGTATTTCTTTGAAACTCCCATTATGGTACAATGTTTTTGTCTTGGATTTTCTTTATAATTTTAATCGATAATTTCACTCAAGTTTTATGCAGTCAATATTAAGATTGTTCTGTTGGTGAATTTGAAATTTCTTTGTCTGTTTGTTTCATCCGTTGTAGCATTAAAAAGAATCGTGAGATCGGTATAAACCATCTAACTTCTTGTGAGATGATTGTAACAAAAGTCTATTTATGGGAGTGTAAAGATTTTAAAGTGTTA
CDS Sequence
Protein Sequence