Information report for AT5G20240
Gene Details
|
|
Functional Descriptions
- PO:0005421 — parenchyma — parénquima (Spanish, exact), portion of parenchyma tissue (exact), portion of parenchymatous tissue (exact), 柔組織 (Japanese, exact)
- PO:0020149 — quiescent center — centro de division de células del meristema (Spanish, exact), 静止中心 (Japanese, exact)
- PO:0003022 — lateral root cap of primary root — caliptra de la raíz lateral de la raíz primaria (Spanish, exact), 一次根の側根冠 (Japanese, exact)
- PO:0006081 — primary root apical meristem — meristema apical de la raíz primaria (Spanish, exact), 一次根頂端分裂組織 (Japanese, exact), apical meristem of primary root (related), embryonic root meristem (related)
- CS77 — lacks petals and anthers.
Functional Keywords
Literature and News
- The Arabidopsis floral homeotic gene PISTILLATA is regulated by discrete cis-elements responsive to induction and maintenance signals. DOI: 10.1242/dev.127.10.2021 ; PMID: 10769227
- The UNUSUAL FLORAL ORGANS gene of Arabidopsis thaliana is an F-box protein required for normal patterning and growth in the floral meristem. DOI: 10.1046/j.1365-313x.1999.00617.x ; PMID: 10607296
- Patterns of molecular evolution among paralogous floral homeotic genes. DOI: 10.1093/oxfordjournals.molbev.a026193 ; PMID: 10474900
- The Arabidopsis FILAMENTOUS FLOWER gene is required for flower formation. DOI: 10.1242/dev.126.12.2715 ; PMID: 10331982
- Identification of genes expressed during early Arabidopsis carpel development by mRNA differential display: characterisation of ATCEL2, a novel endo-1,4-beta-D-glucanase gene. DOI: 10.1046/j.1365-313x.1999.00359.x ; PMID: 10074717
- Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3. DOI: 10.1242/dev.125.9.1711 ; PMID: 9521909
- A homolog of NO APICAL MERISTEM is an immediate target of the floral homeotic genes APETALA3/PISTILLATA. DOI: 10.1016/s0092-8674(00)80902-2 ; PMID: 9489703
- ETTIN patterns the Arabidopsis floral meristem and reproductive organs. DOI: 10.1242/dev.124.22.4481 ; PMID: 9409666
- Determination of floral organ identity by Arabidopsis MADS domain homeotic proteins AP1, AP3, PI, and AG is independent of their DNA-binding specificity. DOI: 10.1091/mbc.8.7.1243 ; PMID: 9243505
- Evolutionary diversity of symbiotically induced nodule MADS box genes: characterization of nmhC5, a member of a novel subfamily. DOI: 10.1094/MPMI.1997.10.5.665 ; PMID: 9204570
- Targeted misexpression of AGAMOUS in whorl 2 of Arabidopsis flowers. DOI: 10.1046/j.1365-313x.1997.11040825.x ; PMID: 9161038
- DNA-binding properties of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA and AGAMOUS. DOI: 10.1093/nar/24.16.3134 ; PMID: 8774892
- Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS. DOI: 10.1073/pnas.93.10.4793 ; PMID: 8643482
- Mapping the protein regions responsible for the functional specificities of the Arabidopsis MADS domain organ-identity proteins. DOI: 10.1073/pnas.93.9.4063 ; PMID: 8633017
- UFO: an Arabidopsis gene involved in both floral meristem and floral organ development. DOI: 10.1105/tpc.7.5.529 ; PMID: 7780306
- Molecular evolution of flower development: diversification of the plant MADS-box regulatory gene family. DOI: 10.1093/genetics/140.1.345 ; PMID: 7635298
- LEUNIG regulates AGAMOUS expression in Arabidopsis flowers. DOI: 10.1242/dev.121.4.975 ; PMID: 7743940
- CLAVATA1, a regulator of meristem and flower development in Arabidopsis. DOI: 10.1242/dev.119.2.397 ; PMID: 8287795
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- HUA1, a regulator of stamen and carpel identities in Arabidopsis, codes for a nuclear RNA binding protein. DOI: 10.1105/tpc.010201 ; PMID: 11595801
- Activation of the Arabidopsis B class homeotic genes by APETALA1. DOI: 10.1105/tpc.13.4.739 ; PMID: 11283333
- The ASK1 gene regulates B function gene expression in cooperation with UFO and LEAFY in Arabidopsis. DOI: 10.1242/dev.128.14.2735 ; PMID: 11526079
- Ectopic expression of rice OsMADS1 reveals a role in specifying the lemma and palea, grass floral organs analogous to sepals. DOI: 10.1007/s004270100153 ; PMID: 11466523
- Complexes of MADS-box proteins are sufficient to convert leaves into floral organs. DOI: 10.1038/35054083 ; PMID: 11206550
- early bolting in short days: an Arabidopsis mutation that causes early flowering and partially suppresses the floral phenotype of leafy. DOI: 00-0536 ; PMID: 11340178
- Contrasting evolutionary forces in the Arabidopsis thaliana floral developmental pathway. DOI: 10.1093/genetics/160.4.1641 ; PMID: 11973317
- LEAFY Interacts with Floral Homeotic Genes to Regulate Arabidopsis Floral Development. DOI: 10.1105/tpc.4.8.901 ; PMID: 12297664
- Global identification of target genes regulated by APETALA3 and PISTILLATA floral homeotic gene action. DOI: 10.1105/tpc.006353 ; PMID: 12509532
- ATX-1, an Arabidopsis homolog of trithorax, activates flower homeotic genes. DOI: 10.1016/s0960-9822(03)00243-4 ; PMID: 12699618
- Arabidopsis TERMINAL FLOWER 2 gene encodes a heterochromatin protein 1 homolog and represses both FLOWERING LOCUS T to regulate flowering time and several floral homeotic genes. DOI: 10.1093/pcp/pcg091 ; PMID: 12826620
- Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: new openings to the MADS world. DOI: 10.1105/tpc.011544 ; PMID: 12837945
- pistillata-5, an Arabidopsis B class mutant with strong defects in petal but not in stamen development. DOI: 10.1046/j.1365-313x.2003.01603.x ; PMID: 12943551
- Transforming petals into sepaloid organs in Arabidopsis and oilseed rape: implementation of the hairpin RNA-mediated gene silencing technology in an organ-specific manner. DOI: 10.1007/s00425-003-1117-1 ; PMID: 14534787
- Genome-wide analysis of spatial gene expression in Arabidopsis flowers. DOI: 10.1105/tpc.021741 ; PMID: 15100403
- Floral homeotic genes are targets of gibberellin signaling in flower development. DOI: 10.1073/pnas.0402377101 ; PMID: 15128937
- Activation of CRABS CLAW in the Nectaries and Carpels of Arabidopsis. DOI: 10.1105/tpc.104.026666 ; PMID: 15598802
- Transcriptional program controlled by the floral homeotic gene AGAMOUS during early organogenesis. DOI: 10.1242/dev.01600 ; PMID: 15634696
- Translational fusions with the engrailed repressor domain efficiently convert plant transcription factors into dominant-negative functions. DOI: 10.1093/nar/gkf591 ; PMID: 12409462
- Transcriptional profile of the Arabidopsis root quiescent center. DOI: 10.1105/tpc.105.031724 ; PMID: 15937229
- A transposon-based activation-tagging population in Arabidopsis thaliana (TAMARA) and its application in the identification of dominant developmental and metabolic mutations. DOI: 10.1016/j.febslet.2005.07.030 ; PMID: 16087178
- The Arabidopsis heterochromatin protein1 homolog (TERMINAL FLOWER2) silences genes within the euchromatic region but not genes positioned in heterochromatin. DOI: 10.1093/pcp/pci195 ; PMID: 16131496
- Expression of floral MADS-box genes in basal angiosperms: implications for the evolution of floral regulators. DOI: 10.1111/j.1365-313X.2005.02487.x ; PMID: 16115069
- Direct regulation of the floral homeotic APETALA1 gene by APETALA3 and PISTILLATA in Arabidopsis. DOI: 10.1111/j.1365-313X.2006.02720.x ; PMID: 16640596
- MGOUN3: evidence for chromatin-mediated regulation of FLC expression. DOI: 10.1093/jxb/erj169 ; PMID: 16728410
- The putative SWI/SNF complex subunit BRAHMA activates flower homeotic genes in Arabidopsis thaliana. DOI: 10.1007/s11103-006-9021-2 ; PMID: 16845477
- BIGPETALp, a bHLH transcription factor is involved in the control of Arabidopsis petal size. DOI: 10.1038/sj.emboj.7601270 ; PMID: 16902407
- DamID, a new tool for studying plant chromatin profiling in vivo, and its use to identify putative LHP1 target loci. DOI: 10.1111/j.1365-313X.2006.02859.x ; PMID: 16972870
- Microarray analysis reveals altered expression of a large number of nuclear genes in developing cytoplasmic male sterile Brassica napus flowers. DOI: 10.1111/j.1365-313X.2006.02975.x ; PMID: 17217466
- Divergent regulatory OsMADS2 functions control size, shape and differentiation of the highly derived rice floret second-whorl organ. DOI: 10.1534/genetics.107.071746 ; PMID: 17409064
- Phosphate differentially regulates 14-3-3 family members and GRF9 plays a role in Pi-starvation induced responses. DOI: 10.1007/s00425-007-0569-0 ; PMID: 17598127
- miR172 regulates stem cell fate and defines the inner boundary of APETALA3 and PISTILLATA expression domain in Arabidopsis floral meristems. DOI: 10.1111/j.1365-313X.2007.03181.x ; PMID: 17573799
- DORNROSCHEN-LIKE, an AP2 gene, is necessary for stamen emergence in Arabidopsis. DOI: 10.1007/s11103-007-9210-7 ; PMID: 17682829
- Two GATA transcription factors are downstream effectors of floral homeotic gene action in Arabidopsis. DOI: 10.1104/pp.107.115634 ; PMID: 18417639
- Interaction study of MADS-domain proteins in tomato. DOI: 10.1093/jxb/ern094 ; PMID: 18487636
- SEPALLATA3: the 'glue' for MADS box transcription factor complex formation. DOI: 10.1186/gb-2009-10-2-r24 ; PMID: 19243611
- Epigenetic regulation of gene programs by EMF1 and EMF2 in Arabidopsis. DOI: 10.1104/pp.109.143495 ; PMID: 19783648
- The SPOROCYTELESS/NOZZLE gene is involved in controlling stamen identity in Arabidopsis. DOI: 10.1104/pp.109.145896 ; PMID: 19726570
- Detection of protein-protein interactions in plants using the transrepressive activity of the EAR motif repression domain. DOI: 10.1111/j.1365-313X.2009.04081.x ; PMID: 19929880
- The Arabidopsis floral homeotic proteins APETALA3 and PISTILLATA negatively regulate the BANQUO genes implicated in light signaling. DOI: 10.1105/tpc.109.065946 ; PMID: 20305124
- Intercellular transport of epidermis-expressed MADS domain transcription factors and their effect on plant morphology and floral transition. DOI: 10.1111/j.1365-313X.2010.04221.x ; PMID: 20374529
- Investigation of MADS domain transcription factor dynamics in the floral meristem. DOI: 10.4161/psb.5.10.12949 ; PMID: 20861681
- Modelling the Molecular Interactions in the Flower Developmental Network of Arabidopsis thaliana. DOI: NA ; PMID: 21685577
- Characterization of MADS-domain transcription factor complexes in Arabidopsis flower development. DOI: 10.1073/pnas.1112871109 ; PMID: 22238427
- Modelling the molecular interactions in the flower developmental network of Arabidopsis thaliana. DOI: 10.3233/ISB-2010-0414 ; PMID: 22430225
- A survey of dominant mutations in Arabidopsis thaliana. DOI: 10.1016/j.tplants.2012.08.006 ; PMID: 22995285
- APETALA2 negatively regulates multiple floral organ identity genes in Arabidopsis by recruiting the co-repressor TOPLESS and the histone deacetylase HDA19. DOI: 10.1242/dev.085407 ; PMID: 23034631
- An Arabidopsis tissue-specific RNAi method for studying genes essential to mitosis. DOI: 10.1371/journal.pone.0051388 ; PMID: 23236491
- Mutations in epidermis-specific HD-ZIP IV genes affect floral organ identity in Arabidopsis thaliana. DOI: 10.1111/tpj.12211 ; PMID: 23590515
- AGAMOUS-LIKE13, a putative ancestor for the E functional genes, specifies male and female gametophyte morphogenesis. DOI: 10.1111/tpj.12363 ; PMID: 24164574
- Arabidopsis SEPALLATA proteins differ in cooperative DNA-binding during the formation of floral quartet-like complexes. DOI: 10.1093/nar/gku755 ; PMID: 25183521
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- Comparative analysis of binding patterns of MADS-domain proteins in Arabidopsis thaliana. DOI: 10.1186/s12870-018-1348-8 ; PMID: 29940855
- Exogenous Promoter Triggers APETALA3 Silencing through RNA-Directed DNA Methylation Pathway in Arabidopsis. DOI: 10.3390/ijms20184478 ; PMID: 31514282
- Mutagenesis of a Quintuple Mutant Impaired in Environmental Responses Reveals Roles for CHROMATIN REMODELING4 in the Arabidopsis Floral Transition. DOI: 10.1105/tpc.19.00992 ; PMID: 32132131
- A transcriptional complex of NGATHA and bHLH transcription factors directs stigma development in Arabidopsis. DOI: 10.1093/plcell/koab236 ; PMID: 34586419
- LEAFY and APETALA1 down-regulate ZINC FINGER PROTEIN 1 and 8 to release their repression on class B and C floral homeotic genes. DOI: 10.1073/pnas.2221181120 ; PMID: 37216511
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Transcriptional and posttranscriptional regulation of transcription factor expression in Arabidopsis roots. DOI: 10.1073/pnas.0510607103 ; PMID: 16581911
Gene Resources
- UniProt: A0A1P8BAQ7
- EMBL: CP002688
- AlphaFoldDB: A0A1P8BAQ7
- EnsemblPlants: AT5G20240.2
- Gramene: AT5G20240.2
- ExpressionAtlas: AT5G20240
- InterPro: IPR002100, IPR002487, IPR033896
- PANTHER: PTHR48019
- SUPFAM: SSF55455
- PROSITE: PS00350, PS50066, PS51297
- Gene3D: 3.40.1810.10
- OrthoDB: A0A1P8BAQ7
- SWISS-MODEL: A0A1P8BAQ7
- Conserved Domain Database: cd00265
Sequences
cDNA Sequence
- >AT5G20240.2
GTGCCCTCAAGAAAGTAGCTTTGTTTTCAATCCCAAACTGTCAAAGTCTCTCTTCACCTCAAGATTAATCAAAACATTTCTCTCTCTATCTCATCAATGTTACTTTAAAACCAATGCTCCTCTTCTTGTTCTTCATATAAACCACATATCCTCTCCTCCATATCTTAACAATTTCATAGCAAACCCTAAAATTGAGAAAGAGATAGAGAGAGAAAGATGGGTAGAGGAAAGATCGAGATAAAGAGGATAGAGAACGCAAACAACAGAGTGGTGACGTTCTCAAAGAGGAGGAATGGATTGGTGAAGAAGGCTAAAGAGATCACAGTTCTTTGTGATGCAAAAGTTGCCCTCATAATCTTTGCAAGTAATGGTAAGATGATTGATTACTGTTGTCCTTCCATGGATCTTGGTGCTATGTTGGACCAATACCAGAAGTTATCTGGCAAGAAACTATGGGATGCTAAGCATGAGAACCTTAGCAATGAGATTGATAGGATCAAGAAAGAGAATGATAGCTTACAACTGGAGCTCAGGCATTTGAAGGGAGAAGATATACAGTCTCTCAACTTGAAAAATCTGATGGCTGTCGAGCACGCCATTGAACATGGCCTCGACAAAGTCCGAGACCACCAGGTATGTATACATTTCTACATACATTCATACACATGAATATATTTAACTTCTTATTTGGTCTGCTTGGCACAGATGGAGATCCTTATATCAAAGAGGAGAAATGAGAAGATGATGGCGGAGGAGCAACGGCAACTCACTTTCCAGCTGCAACAACAGGAGATGGCTATAGCAAGCAACGCAAGAGGAATGATGATGAGAGATCATGATGGGCAGTTTGGATATAGAGTGCAACCGATTCAGCCAAATCTTCAGGAAAAGATTATGTCTTTGGTCATCGATTGATCATCGAGATTTTATAATCTCATCCTGATCAACTCCTATCTATAATATCGTGGTCTTTAGTTTGTCTTTATCAATCTGTGTGTCTTAATCTCGAGCAACATATATACTCGCTATCAGACTTTTTACTTAAGCTATATGTGTGTTGTTTGCTTATGACCTCTATGTATTGGTTGTGTTGTGTGCTTAAACGTTTCGAACTAATTGATCTGTGTGAAACTTATTATTCTGTGATAAGCTATTTGTGATAAAGAAGAAGATCCTTTTCTCTTTCTAAAAGTTAGAATTGTTCTCTAACTAATTTGGAGAG - >AT5G20240.1
GTGCCCTCAAGAAAGTAGCTTTGTTTTCAATCCCAAACTGTCAAAGTCTCTCTTCACCTCAAGATTAATCAAAACATTTCTCTCTCTATCTCATCAATGTTACTTTAAAACCAATGCTCCTCTTCTTGTTCTTCATATAAACCACATATCCTCTCCTCCATATCTTAACAATTTCATAGCAAACCCTAAAATTGAGAAAGAGATAGAGAGAGAAAGATGGGTAGAGGAAAGATCGAGATAAAGAGGATAGAGAACGCAAACAACAGAGTGGTGACGTTCTCAAAGAGGAGGAATGGATTGGTGAAGAAGGCTAAAGAGATCACAGTTCTTTGTGATGCAAAAGTTGCCCTCATAATCTTTGCAAGTAATGGTAAGATGATTGATTACTGTTGTCCTTCCATGGATCTTGGTGCTATGTTGGACCAATACCAGAAGTTATCTGGCAAGAAACTATGGGATGCTAAGCATGAGAACCTTAGCAATGAGATTGATAGGATCAAGAAAGAGAATGATAGCTTACAACTGGAGCTCAGGCATTTGAAGGGAGAAGATATACAGTCTCTCAACTTGAAAAATCTGATGGCTGTCGAGCACGCCATTGAACATGGCCTCGACAAAGTCCGAGACCACCAGGTATGTATACATTTCTACATACATTCATACACATGAATATATTTAACTTCTTATTTGGTCTGCTTGGCACAGATGGAGATCCTTATATCAAAGAGGAGAAATGAGAAGATGATGGCGGAGGAGCAACGGCAACTCACTTTCCAGCTGCAACAACAGGAGATGGCTATAGCAAGCAACGCAAGAGGAATGATGATGAGAGATCATGATGGGCAGTTTGGATATAGAGTGCAACCGATTCAGCCAAATCTTCAGGAAAAGATTATGTCTTTGGTCATCGATTGATCATCGAGATTTTATAATCTCATCCTGATCAACTCCTATCTATAATATCGTGGTCTTTAGTTTGTCTTTATCAATCTGTGTGTCTTAATCTCGAGCAACATATATACTCGCTATCAGACTTTTTACTTAAGCTATATGTGTGTTGTTTGCTTATGACCTCTATGTATTGGTTGTGTTGTGTGCTTAAACGTTTCGAACTAATTGATCTGTGTGAAACTTATTATTCTGTGATAAGCTATTTGTGATAAAGAAGAAGATCCTTTTCTCTTTCTAAAAGTTAGAATTGTTCTCTAACTAATTTGGAGAG
CDS Sequence
Protein Sequence