Gene Details:
- Gene ID: AT5G20230
- Gene Symbol: ATBCB, BCB, BCB, SAG14
- Gene Name: blue-copper-binding protein, BLUE COPPER BINDING PROTEIN, blue-copper-binding protein, SENESCENCE ASSOCIATED GENE 14
- Description: blue-copper-binding protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
Function-related keywords:
Literature:
- Expression of aluminum-induced genes in transgenic arabidopsis plants can ameliorate aluminum stress and/or oxidative stress. DOI: 10.1104/pp.122.3.657 ; PMID: 10712528
- Senescence-associated gene expression during ozone-induced leaf senescence in Arabidopsis. DOI: 10.1104/pp.120.4.1015 ; PMID: 10444084
- Aluminum induces oxidative stress genes in Arabidopsis thaliana. DOI: 10.1104/pp.116.1.409 ; PMID: 9449849
- Different mechanisms of four aluminum (Al)-resistant transgenes for Al toxicity in Arabidopsis. DOI: 6920 ; PMID: 11706174
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- Prediction of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A genomic analysis. DOI: 10.1104/pp.010884 ; PMID: 12068095
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- Bacterial non-host resistance: interactions of Arabidopsis with non-adapted Pseudomonas syringae strains. DOI: 10.1111/j.1399-3054.2007.00977.x ; PMID: 18251883
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Overexpression of wound-responsive RNA-binding proteins induces leaf senescence and hypersensitive-like cell death. DOI: 10.1111/j.1469-8137.2008.02557.x ; PMID: 18705666
- An Arabidopsis (malectin-like) leucine-rich repeat receptor-like kinase contributes to downy mildew disease. DOI: 10.1111/j.1365-3040.2011.02390.x ; PMID: 21711359
- Antioxidant response of Arabidopsis plants to gamma irradiation: Genome-wide expression profiling of the ROS scavenging and signal transduction pathways. DOI: 10.1016/j.jplph.2011.05.008 ; PMID: 21665324
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Oxidative stress-induced toxicity of CuO nanoparticles and related toxicogenomic responses in Arabidopsis thaliana. DOI: 10.1016/j.envpol.2016.03.019 ; PMID: 27016889
- Root Cell-Specific Regulators of Phosphate-Dependent Growth. DOI: 10.1104/pp.16.01698 ; PMID: 28465462
- Integrative Analysis from the Epigenome to Translatome Uncovers Patterns of Dominant Nuclear Regulation during Transient Stress. DOI: 10.1105/tpc.19.00463 ; PMID: 31519798
- A Rapeseed WRKY Transcription Factor Phosphorylated by CPK Modulates Cell Death and Leaf Senescence by Regulating the Expression of ROS and SA-Synthesis-Related Genes. DOI: 10.1021/acs.jafc.0c02500 ; PMID: 32530625
- FATTY ACID DESATURASE5 Is Required to Induce Autoimmune Responses in Gigantic Chloroplast Mutants of Arabidopsis. DOI: 10.1105/tpc.20.00016 ; PMID: 32796124
- The PCY-SAG14 phytocyanin module regulated by PIFs and miR408 promotes dark-induced leaf senescence in Arabidopsis. DOI: 10.1073/pnas.2116623119 ; PMID: 35022242
- Chloroplast Protein Tic55 Involved in Dark-Induced Senescence through AtbHLH/AtWRKY-ANAC003 Controlling Pathway of Arabidopsis thaliana. DOI: 10.3390/genes13020308 ; PMID: 35205352
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- Identification of glycosylphosphatidylinositol-anchored proteins in Arabidopsis. A proteomic and genomic analysis. DOI: 10.1104/pp.103.021170 ; PMID: 12805588
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Proteomic analysis of glycosylphosphatidylinositol-anchored membrane proteins. DOI: 10.1074/mcp.M300079-MCP200 ; PMID: 14517339
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Sequences:
cDNA Sequence
- >AT5G20230.1
ATTGACCACAAGTGATAATATCTAAATTTGGATTTGTTCAACGACACAACACGTAACGCGTCTTCCCGTATCTTGCGTATGACTCCTTGAGAGCCTCTCTTTAATTGTCCTATAAATATAAGTCTCTCTTGCAAGACTTTTGAAACCACAACAAACACAAAAATCAAAAGGGGTCATTTACTATCTTTTAAGAGACGACATATATAGTTCTCGACCAAGAAAAGAAAAGGGGGTGACCTGAGTTCTTCAACACATAACATAATGGCCGGAGTTTTCAAAACGGTTACGTTTCTTGTTTTGGTTTTCGCTGCCGTTGTTGTCTTCGCGGAGGACTACGATGTTGGTGATGATACGGAATGGACGAGACCTATGGACCCCGAGTTCTATACTACTTGGGCTACCGGTAAAACTTTCCGTGTAGGCGACGAGCTCGAATTTGATTTCGCTGCTGGGAGGCATGATGTGGCAGTTGTATCAGAAGCTGCATTTGAAAACTGTGAGAAAGAGAAACCCATTAGCCACATGACCGTTCCTCCGGTCAAAATTATGCTAAACACCACTGGACCACAATACTTTATCTGCACCGTCGGTGACCATTGTCGTTTTGGTCAAAAACTTTCCATCACTGTAGTTGCTGCTGGTGCAACTGGAGGTGCTACTCCTGGTGCCGGTGCTACCCCAGCACCTGGATCAACCCCAAGTACTGGAGGAACCACTCCTCCCACTGCGGGTGGGACCACAACACCTTCAGGCTCTAGCGGAACCACTACTCCAGCTGGAAATGCCGCTTCCTCATTAGGTGGTGCTACTTTTCTGGTCGCTTTTGTTTCTGCTGTTGTTGCTCTCTTTTGAGTCACACTCGAAACCTAGTTATGTATTTGTTTTACCTTACTCTCCTTATTTAAATAGTCATGTATTTGATTATTTGTGAGAATAAGGACTTGTTTTCAAGTCATTATAAACGTCTTATACTTGTGATTAGTATTGAGTTTCAATATATGATTATTCGGTTGCAAAATAAAGAGTGGGTTTCAATATCATTGAGATTACTACTATATATTACCATATTTCATGAAAATTAGTCATCTTCTTCATCCAATTTGTCTAGTTTTCATGTATAATTAGACAAAATTTGCCTTCTCAATATTTTCAATCAACGAGTAAACATTACCTGATTGTGAACCGAAGTTAG
CDS Sequence
Protein Sequence