Information report for AT5G20150
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
Functional Keywords
Literature and News
- Structure and expression profile of the Arabidopsis PHO1 gene family indicates a broad role in inorganic phosphate homeostasis. DOI: 10.1104/pp.103.037945 ; PMID: 15122012
- Transcriptional profiling by cDNA-AFLP and microarray analysis reveals novel insights into the early response to ethylene in Arabidopsis. DOI: 10.1111/j.1365-313X.2004.02156.x ; PMID: 15272873
- Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. DOI: 10.1105/tpc.104.022699 ; PMID: 15319476
- Microarray analysis reveals vegetative molecular phenotypes of Arabidopsis flowering-time mutants. DOI: 10.1093/pcp/pci128 ; PMID: 15908439
- Gene expression changes in Arabidopsis thaliana seedling roots exposed to the munition hexahydro-1,3,5-trinitro-1,3,5-triazine. DOI: 10.1021/es050385r ; PMID: 16173598
- PHO2, microRNA399, and PHR1 define a phosphate-signaling pathway in plants. DOI: 10.1104/pp.106.079707 ; PMID: 16679424
- Genome-wide analysis of the Arabidopsis leaf transcriptome reveals interaction of phosphate and sugar metabolism. DOI: 10.1104/pp.106.090167 ; PMID: 17085508
- Global transcript levels respond to small changes of the carbon status during progressive exhaustion of carbohydrates in Arabidopsis rosettes. DOI: 10.1104/pp.107.115592 ; PMID: 18305208
- Increased expression of OsSPX1 enhances cold/subfreezing tolerance in tobacco and Arabidopsis thaliana. DOI: 10.1111/j.1467-7652.2009.00423.x ; PMID: 19508276
- Vacuolar Ca2+/H+ transport activity is required for systemic phosphate homeostasis involving shoot-to-root signaling in Arabidopsis. DOI: 10.1104/pp.111.175257 ; PMID: 21546457
- SPX1 is a phosphate-dependent inhibitor of Phosphate Starvation Response 1 in Arabidopsis. DOI: 10.1073/pnas.1404654111 ; PMID: 25271326
- Differentiating phosphate-dependent and phosphate-independent systemic phosphate-starvation response networks in Arabidopsis thaliana through the application of phosphite. DOI: 10.1093/jxb/erv025 ; PMID: 25697796
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Iron and Phosphate Deficiency Regulators Concertedly Control Coumarin Profiles in Arabidopsis thaliana Roots During Iron, Phosphate, and Combined Deficiencies. DOI: 10.3389/fpls.2019.00113 ; PMID: 30804973
- SPX4 Acts on PHR1-Dependent and -Independent Regulation of Shoot Phosphorus Status in Arabidopsis. DOI: 10.1104/pp.18.00594 ; PMID: 31262954
- Integrative Analysis from the Epigenome to Translatome Uncovers Patterns of Dominant Nuclear Regulation during Transient Stress. DOI: 10.1105/tpc.19.00463 ; PMID: 31519798
- Nitrate-inducible NIGT1 proteins modulate phosphate uptake and starvation signalling via transcriptional regulation of SPX genes. DOI: 10.1111/tpj.14637 ; PMID: 31811679
- Photosynthetic response to increased irradiance correlates to variation in transcriptional response of lipid-remodeling and heat-shock genes. DOI: 10.1002/pld3.69 ; PMID: 31245733
- NIGT1 family proteins exhibit dual mode DNA recognition to regulate nutrient response-associated genes in Arabidopsis. DOI: 10.1371/journal.pgen.1009197 ; PMID: 33137118
- Characterization of a sub-family of Arabidopsis genes with the SPX domain reveals their diverse functions in plant tolerance to phosphorus starvation. DOI: 10.1111/j.1365-313X.2008.03460.x ; PMID: 18315545
Gene Resources
- UniProt: A0A654G2V5
- EMBL: CACRSJ010000110
- AlphaFoldDB: A0A654G2V5
- EnsemblPlants: AT5G20150.1
- Gramene: AT5G20150.1
- KEGG: ath:AT5G20150
- Orthologous matrix: CATPRDI
- ExpressionAtlas: AT5G20150
- InterPro: IPR004331, IPR031142
- PANTHER: PTHR45978, PTHR45978:SF10
- PROSITE: PS51382
- SWISS-MODEL: A0A654G2V5
- Conserved Domain Database: cd14481
Sequences
cDNA Sequence
- >AT5G20150.1
CGAAAGAAAGACAGAGAAAAAAGGATATTCTAATTAGAAACCTTAAGAATATTCTTTTTAATCCCTTTTATATCTCTAAACCTCTTCCCCCTCTCTTTCTTCTTCATTCATCATTCTCACTTAAGTTTCCCAGAAAATAAAAGAGCTATGAAGTTTGGTAAGAGTCTCAGCAATCAGATCGAGCAAACTCTTCCTGAATGGCAAGACAAGTTCTTGTCTTACAAAGAACTCAAAAAACGACTCAAACTCATCGGTTCCAAAACCGCCGATCGTCCCGTTAAACGACTCCGTTTAGATGAGTTTTCCGTCGGAATATCGAAAGAAGAGATCAATTTCATCCAATTGTTAGAAGACGAGTTGGAGAAATTCAACAATTTCTTCGTTGAGAAGGAAGAAGAATATATCATCAGACTAAAGGAATTTAGAGATAGAATTGCGAAAGCTAAGGATTCAATGGAGAAGATGATAAAAATCAGGAAGGAGATTGTTGATTTCCATGGAGAAATGGTTCTTCTTGAGAATTACAGTGCTCTTAATTACACTGGATTGGTTAAGATACTGAAGAAGTATGACAAAAGAACTGGTGATCTCATGCGTTTACCTTTCATCCAGAAAGTTCTTCAGCAACCTTTTTACACTACTGACTTATTGTTCAAGCTTGTCAAGGAATCTGAGGCAATGCTTGATCAGATCTTCCCTGCTAACGAAACTGAGTCTGAGATTATCCAAGCAGAGTTATCAGAGCATAAGTTCATGGAGAGTCTTCATATGAAGAGCACAATCGCTGCCTTGCGGGTTTTGAAGGAGATCAGGAGTGGAAGTTCTACTGTTAGTGTGTTTTCATTGCCGCCTCTACAGTTAAATGGCTTAGATGAGACATGGAAGAAGATTCCATTGTTGGAGCAAGAAGCCAAATAGAGAGTGAGACAGAGGCACACTCGCTCTATTCCACTTTTTTATACAATAGAAGAAGCTAACAGATTAAACAAGACATTATCATCAATGTACACAAAAAGGCAGAAGAAACTATAGGATCATGTTTCTGGATATCATCTTTGGTCGGTCATAAGTCCTTAGGTTACACAAAACTGCAATGTAACTTTGTTTCTGTGTTGGGTGTGTTGTAGTTGATGTAATATATACCACTTCAGATTAATTATTGATTTCTTCTTTTCCAAAGTCATATGCTAGATATTTCAAGTTCTC
CDS Sequence
Protein Sequence