Information report for AT5G19780
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0005020 — vascular bundle — haz vascular (Spanish, exact), vein (exact), 維管束 (Japanese, exact)
- GO:0007017 — acts upstream of or within — microtubule-based process
- GO:0009505 — located in — plant-type cell wall
- GO:0005634 — located in — nucleus
- GO:0005200 — enables — structural constituent of cytoskeleton
- GO:0045298 — part of — tubulin complex
- GO:0009536 — located in — plastid
- GO:0005525 — enables — GTP binding
- GO:0005874 — is active in — microtubule
- GO:0000226 — involved in — microtubule cytoskeleton organization
- GO:0009506 — located in — plasmodesma
- GO:0000278 — involved in — mitotic cell cycle
- GO:0005737 — is active in — cytoplasm
- CS68884 — Right-handed helical growth in the root and other rapidly elongating organs. Medium severity of cell expansion defects.
Functional Keywords
Literature and News
- The small genome of Arabidopsis contains at least six expressed alpha-tubulin genes. DOI: 10.1105/tpc.4.5.539 ; PMID: 1498608
- Isolation, sequence analysis, and expression studies of florally expressed cDNAs in Arabidopsis. DOI: 10.1023/B:PLAN.0000019063.18097.62 ; PMID: 15010618
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- Low-level radiocaesium exposure alters gene expression in roots of Arabidopsis. DOI: 10.1111/j.1469-8137.2005.01485.x ; PMID: 16159328
- Dynamic histone acetylation of late embryonic genes during seed germination. DOI: 10.1007/s11103-005-2081-x ; PMID: 16307366
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- Transcriptome analysis of auxin-regulated genes of Arabidopsis thaliana. DOI: 10.1016/j.gene.2008.05.017 ; PMID: 18577427
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- A proteomic analysis of Arabidopsis thaliana seedling responses to 3-oxo-octanoyl-homoserine lactone, a bacterial quorum-sensing signal. DOI: 10.1016/j.bbrc.2012.09.044 ; PMID: 22995300
- A survey of dominant mutations in Arabidopsis thaliana. DOI: 10.1016/j.tplants.2012.08.006 ; PMID: 22995285
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Evaluation of two-dimensional electrophoresis and liquid chromatography–tandem mass spectrometry for tissue-specific protein profiling of laser-microdissected plant samples. DOI: 10.1002/elps.200410399 ; PMID: 15971193
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- Analysis of the Arabidopsis cytosolic proteome highlights subcellular partitioning of central plant metabolism. DOI: 10.1021/pr1009433 ; PMID: 21166475
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A178UTQ9
- EMBL: CACRSJ010000110, CACSHJ010000096, LR881470
- AlphaFoldDB: A0A178UTQ9
- EnsemblPlants: AT5G19770.1, AT5G19780.1
- Gramene: AT5G19770.1, AT5G19780.1
- KEGG: ath:AT5G19770, ath:AT5G19780
- Orthologous matrix: EVRCGAY
- ExpressionAtlas: AT5G19780
- InterPro: IPR000217, IPR002452, IPR003008
- PANTHER: PTHR11588
- SUPFAM: SSF52490, SSF55307
- PROSITE: PS00227, PS00228
- Gene3D: 1.10.287.600, 3.30.1330.20, 3.40.50.1440
- OrthoDB: A0A178UTQ9
- SWISS-MODEL: A0A178UTQ9
- Conserved Domain Database: cd02186
Sequences
cDNA Sequence
- >AT5G19780.1
ATCAAATCCAATTCAATAAATTAATCATTTTCCCTTCACAAAATATAAACCTAATTTGCCAACGAAGTTGAACCAAAAAAAGAAGATCTCACTCTCACCGCCTTCATTTCCTCGATCTCCGTCTTCCTCCTTCTCCGTCTGTCGCAGAGCATCGCTCGAATTAGGGTTTCTGCTGAGAGAAGATGAGGGAAATTATTAGCATTCATATCGGACAAGCCGGGATCCAAGTCGGAAATTCCTGCTGGGAGCTTTACTGTCTCGAACATGGAATCCAGCCCGACGGAATGATGCCGAGTGATACTACAGTTGGTGTTGCACACGATGCGTTCAATACTTTCTTTAGCGAGACTGGAGCTGGGAAGCATGTTCCTAGGGCTGTCTTCGTTGATCTCGAGCCTACCGTTATCGACGAAGTTCGTACTGGTACTTACCGTCAACTTTTCCATCCAGAGCAGCTCATTTCTGGGAAAGAAGATGCTGCTAACAACTTCGCTAGAGGACATTACACTGTTGGAAAGGAAATTGTGGATCTATGTCTTGACCGTGTGAGGAAGCTTGCCGACAACTGTACTGGCTTACAAGGGTTTTTGGTGTTCAATGCTGTTGGTGGTGGAACTGGTTCTGGATTGGGTTCTCTGTTGCTAGAGCGTTTGTCTGTAGATTACGGAAAGAAGTCTAAGCTTGGTTTTACCATATACCCTTCTCCTCAGGTTTCTACTGCTGTTGTAGAGCCTTACAACAGTGTGCTTTCAACGCATTCCCTTCTTGAACATACCGATGTAGCTGTCCTCTTGGATAACGAAGCCATCTATGACATTTGCCGCAGATCCCTAGATATCGAGAGGCCAACCTACACAAACTTGAACAGGTTGATATCACAGATCATTTCATCCTTGACAACATCTTTGAGGTTTGATGGTGCCATCAACGTGGATATCACTGAGTTCCAGACCAATCTTGTCCCATATCCCCGTATCCATTTCATGCTGTCATCTTATGCACCAGTCATCTCAGCCGCCAAGGCTTACCACGAGCAGCTATCAGTCCCTGAGATCACCAATGCCGTGTTTGAGCCAGCGAGCATGATGGCAAAGTGTGACCCAAGGCACGGAAAGTACATGGCATGTTGTTTGATGTACCGAGGAGATGTTGTTCCCAAAGATGTTAATGCTGCCGTTGGCACCATCAAGACAAAGAGGACTGTTCAGTTTGTTGACTGGTGCCCAACTGGGTTCAAATGTGGAATCAACTACCAACCTCCAACAGTTGTTCCAGGTGGTGACCTCGCTAAGGTTCAGAGAGCTGTATGCATGATCAGTAACAACACAGCAGTTGCAGAGGTGTTCTCACGGATCGACCACAAGTTTGATCTCATGTATGCGAAGAGGGCATTCGTGCACTGGTACGTTGGTGAAGGAATGGAGGAAGGTGAATTCTCTGAGGCACGTGAAGACTTGGCCGCACTGGAGAAAGACTACGAAGAAGTTGGTGCTGAAGGTGGAGACGATGAAGAAGATGAAGGTGAAGACTATTGACACCTTTTCTCAAGCAATGTGCTACCAAAAAGTTTTTTCGTTTATCTGTTTTCATTAATGATTCTTGTTGATTACATGTTTGTTTTAATCCTGTACAATATTCGATCCTCCTTCGTGTTTCATCTCGGTTAGATACATTTTCATTGGTAGAGCGACCATTGGGGAAGATCCCGAGTTCATTATCAAGCTTTTGTTGTACGAAACCTTCATTATCTTCTTACATTGTCCATTTTCTTTAGGTACAA
CDS Sequence
Protein Sequence