Gene Details:
- Gene ID: AT5G19770
- Gene Symbol: TUA3
- Gene Name: tubulin alpha-3
- Description: tubulin alpha-3;(source:Araport11)
- TAIR Accession: locus:2183259
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0045298 — part of — tubulin complex
- GO:0005200 — enables — structural constituent of cytoskeleton
- GO:0071258 — acts upstream of or within — cellular response to gravity
- GO:0005886 — located in — plasma membrane
- GO:0009506 — located in — plasmodesma
- GO:0009536 — located in — plastid
- GO:0007017 — involved in — microtubule-based process
- GO:0005634 — located in — nucleus
- GO:0005829 — located in — cytosol
- GO:0009505 — located in — plant-type cell wall
Germplasm Phenotype:
- CS68877 — Left-handed helical growth in the root and other rapidly elongating organs. The level of severity of cell expansion defects is weak. Semidominant in growth response to propyzamide, but recessive for skewed helical growth in the root and other rapidly elongating organs.
- CS68878 — Left-handed helical growth in the root and other rapidly elongating organs. The level of severity of cell expansion defects is weak. Semidominant in growth response to propyzamide, but recessive for skewed helical growth in the root and other rapidly elongating organs.
Function-related keywords:
Literature:
- Maize alpha-tubulin genes are expressed according to specific patterns of cell differentiation. DOI: 10.1023/a:1006067710312 ; PMID: 9700078
- The small genome of Arabidopsis contains at least six expressed alpha-tubulin genes. DOI: 10.1105/tpc.4.5.539 ; PMID: 1498608
- Alternative splicing modulation by a LAMMER kinase impinges on developmental and transcriptome expression. DOI: 10.1105/tpc.011056 ; PMID: 12671088
- Changes in the endoplasmic reticulum lipid properties in response to low temperature in Brassica napus. DOI: 10.1016/j.plaphy.2004.10.001 ; PMID: 15596101
- Extracellular ATP functions as an endogenous external metabolite regulating plant cell viability. DOI: 10.1105/tpc.105.036806 ; PMID: 16199612
- Regulation of plant defense responses in Arabidopsis by EDR2, a PH and START domain-containing protein. DOI: 10.1111/j.1365-313X.2005.02523.x ; PMID: 16212604
- Proteomic analysis of different mutant genotypes of Arabidopsis led to the identification of 11 proteins correlating with adventitious root development. DOI: 10.1104/pp.105.067868 ; PMID: 16377752
- Proteomic investigation of the effect of salicylic acid on Arabidopsis seed germination and establishment of early defense mechanisms. DOI: 10.1104/pp.106.082057 ; PMID: 16679420
- A putative hydroxysteroid dehydrogenase involved in regulating plant growth and development. DOI: 10.1104/pp.107.100560 ; PMID: 17616511
- Proteomics studies of brassinosteroid signal transduction using prefractionation and two-dimensional DIGE. DOI: 10.1074/mcp.M700358-MCP200 ; PMID: 18182375
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Powdery mildew resistance conferred by loss of the ENHANCED DISEASE RESISTANCE1 protein kinase is suppressed by a missense mutation in KEEP ON GOING, a regulator of abscisic acid signaling. DOI: 10.1104/pp.108.127605 ; PMID: 18815384
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Manganese deficiency alters the patterning and development of root hairs in Arabidopsis. DOI: 10.1093/jxb/ern195 ; PMID: 18772308
- Gravity-induced modifications to development in hypocotyls of Arabidopsis tubulin mutants. DOI: 10.1104/pp.109.147330 ; PMID: 20018592
- Proteomic analyses of apoplastic proteins from germinating Arabidopsis thaliana pollen. DOI: 10.1016/j.bbapap.2011.07.013 ; PMID: 21798377
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- Analysis of the Arabidopsis cytosolic proteome highlights subcellular partitioning of central plant metabolism. DOI: 10.1021/pr1009433 ; PMID: 21166475
Sequences:
cDNA Sequence
- >AT5G19770.1
GTTATTTAAACCGGATAAAAATCGACACCTTCCAGATCTAGATCCAGATCGAATCTCACGTATTTTGTCTATGCCCAGTCCCAAAGGCAGGCTGTCACAACTTGGCGGACCCCAACCAATTATCAAATCTCATTCAATAAATAATCAATTTCCCACAAAAATCATGGAAATTAGGAAAAAAAGAAGATCTCGCTCACCGCTCTCATTTCCTCAATTCTCCGTCCGTCGAAGAAGCGAATCGCTCGAAATTAGGGTTTCTACTGAGAGAAGATGCGAGAAATCATAAGCATTCACATCGGACAAGCTGGGATCCAGGTCGGAAATTCGTGTTGGGAGCTTTACTGTCTCGAACATGGAATCCAGCCGGACGGAATGATGCCGAGTGATACTACAGTTGGTGTTGCACACGATGCGTTCAATACTTTCTTTAGCGAGACTGGTGCTGGGAAGCATGTCCCTAGGGCTGTCTTCGTTGATCTCGAGCCTACCGTTATCGACGAAGTTCGTACTGGTACTTACCGTCAACTTTTCCATCCAGAGCAGCTCATTTCTGGGAAAGAAGATGCTGCTAACAACTTCGCTAGAGGACATTACACTGTTGGGAAGGAAATTGTGGATCTATGTCTTGACCGTGTGAGGAAACTTGCCGACAACTGTACTGGCTTACAAGGGTTTTTGGTGTTCAATGCTGTTGGTGGTGGAACTGGTTCTGGATTGGGTTCTCTGTTGCTAGAGCGTTTGTCTGTAGATTATGGAAAGAAGTCTAAGCTTGGTTTTACCATATACCCTTCTCCTCAGGTTTCTACTGCTGTTGTAGAACCTTACAACAGTGTTCTCTCAACGCATTCCCTTCTTGAACATACGGATGTAGCTGTCCTCTTGGATAACGAAGCCATCTATGACATTTGCCGCAGATCCCTAGATATCGAGAGGCCAACCTACACAAACTTGAACAGGTTGATATCACAGATCATTTCATCCTTGACAACATCTTTGAGGTTTGATGGTGCCATCAACGTGGATATCACTGAGTTCCAGACCAATCTTGTCCCATATCCCCGTATCCATTTCATGCTGTCATCTTATGCACCAGTCATCTCAGCCGCCAAGGCTTACCACGAGCAGCTATCAGTCCCTGAGATCACCAATGCCGTTTTTGAGCCAGCTAGCATGATGGCAAAGTGTGACCCGAGACACGGAAAGTACATGGCCTGTTGTTTGATGTACCGAGGAGATGTTGTTCCCAAAGATGTTAATGCTGCTGTTGGCACCATCAAGACAAAGAGGACTGTTCAGTTTGTTGACTGGTGCCCAACTGGGTTCAAATGTGGAATCAACTACCAACCTCCAACAGTTGTTCCAGGTGGTGACCTCGCTAAGGTTCAGAGAGCTGTATGTATGATCAGTAACAACACAGCAGTTGCAGAGGTGTTCTCACGGATCGACCACAAGTTTGATCTCATGTATGCGAAGAGGGCATTTGTCCACTGGTACGTTGGTGAAGGAATGGAGGAAGGTGAATTCTCTGAGGCACGTGAAGACTTGGCCGCACTGGAGAAAGATTACGAAGAAGTTGGTGCTGAAGGTGGAGACGATGAAGAAGATGAAGGTGAAGACTATTGACACCTTTTCTCAAAAAAACTGCAACCAAAAAAAGTTTTTTCGTTTATCTGTTTTCACTTTTGATTCTGTTGATTGTTTAAATCCTGTAAAATATTCGTTCGGTCTTCGTGTTTTATCTCGGTTGGATACATTTTCATTGGTAGAGCGACCATTGCGAGTTCCCGAGTTCATTATCAAGCTTTTGTTGTACCAAACTTTGATAATCTTCTTACAACTGTCCATTTTTCCTTGAAGTATAATCTCGTCTATCGGTGCGCTAACGTTTATCAACGTTCTGTATATGCTTTGTTGTCGTATCAGCTAATAATACATTTATGAGATTCAACTAATGTTAACAAACC
CDS Sequence
Protein Sequence