Gene Details:
- Gene ID: AT5G18170
- Gene Symbol: GDH1
- Gene Name: glutamate dehydrogenase 1
- Description: glutamate dehydrogenase 1;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0000071 — companion cell — célula acompañiante (Spanish, exact), minor vein companion cell (exact), 伴細胞 (Japanese, exact)
Germplasm Phenotype:
- CS3975 — deficient in glutamate dehydrogenase; conditional phenotype: impaired root growth and mild shoot chlorosis under intermediate/high inorganic nitrogen conditions, this is exagerated when plants are grown in high concentrations of inorganic nitrogen under suboptimal conditions( e.g. without vitamins); seedling growth is specifically retarded on media containing exogenously supplied inorganic nitrogen.
- CS860072 — No visible phenotype.
- CS860073 — No visible phenotype.
- CS860075 — Reduced plant growth when grown on media containing glutamate as the nitrogen source; susceptible to prolonged darkness.
Function-related keywords:
Literature:
- Analysis of the Arabidopsis mitochondrial proteome. DOI: 6919 ; PMID: 11743115
- Proteomic approach to identify novel mitochondrial proteins in Arabidopsis. DOI: 6987 ; PMID: 11743114
- Generation of Arabidopsis protein chips for antibody and serum screening. DOI: 10.1023/a:1025424814739 ; PMID: 14558660
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- The Arabidopsis root transcriptome by serial analysis of gene expression. Gene identification using the genome sequence. DOI: 10.1104/pp.103.030536 ; PMID: 14730065
- Isolation of intact vacuoles and proteomic analysis of tonoplast from suspension-cultured cells of Arabidopsis thaliana. DOI: 10.1093/pcp/pch099 ; PMID: 15215502
- Transcript profiling in the chl1-5 mutant of Arabidopsis reveals a role of the nitrate transporter NRT1.1 in the regulation of another nitrate transporter, NRT2.1. DOI: 10.1105/tpc.104.024380 ; PMID: 15319483
- A Robot-based platform to measure multiple enzyme activities in Arabidopsis using a set of cycling assays: comparison of changes of enzyme activities and transcript levels during diurnal cycles and in prolonged darkness. DOI: 10.1105/tpc.104.025973 ; PMID: 15548738
- Coordination of nuclear and mitochondrial genome expression during mitochondrial biogenesis in Arabidopsis. DOI: 10.1105/tpc.104.030254 ; PMID: 15829605
- Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis. DOI: 10.1111/j.1365-313X.2005.02399.x ; PMID: 15860015
- Identification of plant glutaredoxin targets. DOI: 10.1089/ars.2005.7.919 ; PMID: 15998247
- Dynamics of Arabidopsis thaliana soluble proteome in response to different nutrient culture conditions. DOI: 10.1002/elps.200500561 ; PMID: 16358359
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Effect of sugar-induced senescence on gene expression and implications for the regulation of senescence in Arabidopsis. DOI: 10.1007/s00425-006-0243-y ; PMID: 16514542
- XcisClique: analysis of regulatory bicliques. DOI: 10.1186/1471-2105-7-218 ; PMID: 16630346
- Proteomic investigation of the effect of salicylic acid on Arabidopsis seed germination and establishment of early defense mechanisms. DOI: 10.1104/pp.106.082057 ; PMID: 16679420
- Integration of metabolite with transcript and enzyme activity profiling during diurnal cycles in Arabidopsis rosettes. DOI: 10.1186/gb-2006-7-8-R76 ; PMID: 16916443
- Systems approach identifies an organic nitrogen-responsive gene network that is regulated by the master clock control gene CCA1. DOI: 10.1073/pnas.0800211105 ; PMID: 18344319
- Divalent metal ions in plant mitochondria and their role in interactions with proteins and oxidative stress-induced damage to respiratory function. DOI: 10.1104/pp.109.147942 ; PMID: 20018591
- Characterization of a NADH-dependent glutamate dehydrogenase mutant of Arabidopsis demonstrates the key role of this enzyme in root carbon and nitrogen metabolism. DOI: 10.1105/tpc.112.103689 ; PMID: 23054470
- Nitrogen remobilization during leaf senescence: lessons from Arabidopsis to crops. DOI: 10.1093/jxb/erw365 ; PMID: 27707774
- Capturing the phosphorylation and protein interaction landscape of the plant TOR kinase. DOI: 10.1038/s41477-019-0378-z ; PMID: 30833711
- STOP1 regulates the expression of HsfA2 and GDHs that are critical for low-oxygen tolerance in Arabidopsis. DOI: 10.1093/jxb/erz124 ; PMID: 30882866
- High affinity promoter binding of STOP1 is essential for early expression of novel aluminum-induced resistance genes GDH1 and GDH2 in Arabidopsis. DOI: 10.1093/jxb/erab031 ; PMID: 33481007
- Analysis of the Arabidopsis mitochondrial proteome. DOI: 6919 ; PMID: 11743115
- Proteomic approach to identify novel mitochondrial proteins in Arabidopsis. DOI: 6987 ; PMID: 11743114
- Experimental analysis of the Arabidopsis mitochondrial proteome highlights signaling and regulatory components, provides assessment of targeting prediction programs, and indicates plant-specific mitochondrial proteins. DOI: 10.1105/tpc.016055 ; PMID: 14671022
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Analysis of the soluble ATP-binding proteome of plant mitochondria identifies new proteins and nucleotide triphosphate interactions within the matrix. DOI: 10.1021/pr060403j ; PMID: 17137349
- Comparative proteomic analysis of NaCl stress-responsive proteins in Arabidopsis roots. DOI: 10.1093/jxb/erm207 ; PMID: 17916636
- Heterogeneity of the mitochondrial proteome for photosynthetic and non-photosynthetic Arabidopsis metabolism. DOI: 10.1074/mcp.M700535-MCP200 ; PMID: 18385124
Sequences:
cDNA Sequence
- >AT5G18170.1
GTTACAATCAGACTGACACCAATCTTCCTCTTTAACAGTCGTTTTATTACAGCGTTCTGATCAAAACTCCAGTGAAAGTTCAAAGTACACAGAGAGAAACAAAAAAAGAAGAAGAAGAAGTTGAAGAAGAAGAAGCCATGAATGCTTTAGCAGCAACAAACAGAAACTTCAAGTTAGCTGCTAGGCTTCTTGGTCTGGATTCTAAGCTCGAGAAAAGTCTTCTCATCCCCTTCCGAGAAATCAAGGTGGAATGTACCATACCGAAAGACGATGGTACACTAGCATCATTCGTTGGGTTCAGAGTTCAACACGACAATGCAAGAGGTCCCATGAAAGGTGGAATCAGATATCATCCTGAGGTTGATCCGGATGAAGTGAACGCATTGGCTCAGCTCATGACATGGAAAACAGCAGTGGCTAAGATTCCTTACGGAGGAGCTAAAGGAGGGATTGGTTGTGATCCTAGCAAGCTCAGTATCTCCGAGCTCGAGCGGTTGACTCGAGTTTTCACTCAGAAGATTCATGATCTCATTGGGATTCATACTGATGTTCCAGCTCCAGATATGGGCACTGGTCCTCAGACAATGGCTTGGATTCTTGATGAATACTCTAAGTTTCATGGATACTCGCCTGCAGTTGTGACTGGAAAACCCATTGATCTTGGTGGATCGCTAGGGAGAGACGCGGCTACTGGAAGAGGAGTGATGTTTGGTACCGAAGCTTTGCTTAACGAGCACGGAAAGACCATATCAGGGCAGCGTTTTGTCATCCAGGGATTTGGTAATGTGGGTTCTTGGGCGGCAAAGCTGATAAGTGAAAAGGGTGGGAAGATTGTTGCCGTGAGTGACATTACCGGAGCAATCAAGAACAAGGATGGTATCGATATCCCGGCCTTGCTCAAGCATACTAAAGAACACAGAGGTGTCAAAGGGTTTGATGGTGCAGATCCGATCGATCCAAACTCCATACTGGTTGAGGATTGTGATATCCTCGTCCCTGCAGCACTTGGTGGTGTCATCAACAGGGAGAATGCGAATGAGATTAAAGCAAAGTTCATCATAGAAGCAGCTAATCATCCAACTGATCCGGACGCGGATGAGATCCTAAGTAAGAAAGGTGTGGTTATTCTCCCGGACATATATGCAAACTCTGGAGGAGTCACTGTAAGTTACTTCGAATGGGTTCAGAACATTCAAGGCTTTATGTGGGAGGAAGAGAAGGTGAACGATGAGCTAAAGACTTACATGACTCGCTCTTTCAAGGACTTGAAAGAGATGTGCAAAACTCACTCTTGCGATCTCCGGATGGGAGCTTTCACACTCGGTGTTAATCGTGTGGCTCAAGCTACCATTCTCAGAGGCTGGGGAGCTTAAAGATTATCTAATCTCTTATGCAATCTCTTTAGCAGCTCCTGAATAAGAATTGAGCCAAACTTTAATCTACTTTTTGTTTTATCCTCCTACTTTGGCTTAGAGGTCATCCTGAGTTAACAGATATGTGTTTACAAGTACTAGAAGACGCTTCTGTATGTAATAAAACCTTGGACTCTAATAGTTAATGAGCTTTTTTACTCTCTTGTTAATAAAACCAAGGTATCAAAAAACTAGAACCAAGAAAACAGTTATCATCAATATGGTTCTTAAAAAAAGCAATTTAAAGATAGCTTAAGGCTATAGAATATGAATCTAGGCCCTCCCTCGGCCTCTGAAGCCTCCACGAGGACCACCTCTTGGTTGAAACCCTCTGCTAGCACCTCTGGGAGCACCTCTACCTCTGAAATTGCCTCTACCACGGGGAGGCCCTCTACCACGGGGAGGGACTCTTCCTTCACCACGGCCTCCTGATTGTCCC
CDS Sequence
Protein Sequence