Information report for AT5G17990
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- CS6247 — severe tryptophan auxotroph (requires tryptophan); blue fluorescence under long and short wave UV light; resistant to 5-methylanthranilate and 6-methylanthranilate; very small, yellow green plants, slow growing, bushy inflorescence with numerous lateral branches, abnormal flowers, reduced fertility
- CS8157 — tryptophan auxotroph; blue fluorescent under long and short wave UV radiation; resistant to 5-methylanthranilate and 6-methylanthranilate; slow growing and stunted plants; bushy inflorescence with numerous lateral branches; abnormal flowers, reduced fertility.
- CS8158 — tryptophan auxotroph; blue fluorescent under long and short wave UV radiation; resistant to 5-methylanthranilate and 6-methylanthranilate; slow growing and stunted plants; bushy inflorescence with numerous lateral branches; abnormal flowers, reduced fertility, segregating for glabra, gl1 (lacks trichomes on stems and leaves) and segregating for trp1-2.
- CS8159 — tryptophan auxotroph (requires tryptophan); blue fluorescent under long and short wave UV light; resistant to 5-methylanthranilate and 6-methylanthranilate; slow growing and stunted plants; bushy inflorescence with numerous lateral branches; abnormal flowers, reduced fertility.
- CS8161 — blue fluorescent under long and short wave UV light; resistant to 5-methylanthranilate and 6-methylanthranilate.
- CS8162 — trp1-101: blue fluorescent under long and short wave UV light; resistant to 5-methylanthranilate and 6-methylanthranilate; gl1-1: lacks trichomes on stems and leaves.
- CS8163 — blue fluorescent under long and short wave UV light; resistant to 5-methylanthranilate and 6-methylanthranilate.
- CS8164 — blue fluorescent under long and short wave UV light; resistant to 5-methylanthranilate and 6-methylanthranilate; yellow seeds, probably due to close linkage to tt4 mutation.
- CS8165 — weakly blue fluorescent under long and short wave UV light; resistant to 5-methylanthranilate and 6-methylanthranilate; slight cross-resistance to analogs of other amino acids; lacks trichomes on stems and leaves.
- CS8166 — very weakly blue fluorescent under long and short wave UV light; resistant to 5-methylanthranilate and 6-methylanthranilate.
- CS8167 — blue fluorescent under long and short wave UV light; resistant to 5-methylanthranilate and 6-methylanthranilate.
- SALK_142670 — Ovule abortion.
Functional Keywords
Literature and News
- Suppressors of trp1 fluorescence identify a new arabidopsis gene, TRP4, encoding the anthranilate synthase beta subunit. DOI: 10.1105/tpc.5.9.1011 ; PMID: 8400875
- Glucose conjugation of anthranilate by the Arabidopsis UGT74F2 glucosyltransferase is required for tryptophan mutant blue fluorescence. DOI: 10.1074/jbc.M211822200 ; PMID: 12475971
- Analysis of indole-3-butyric acid-induced adventitious root formation on Arabidopsis stem segments. DOI: 10.1093/jxb/eri208 ; PMID: 15955788
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Identification of proteins enriched in rice egg or sperm cells by single-cell proteomics. DOI: 10.1371/journal.pone.0069578 ; PMID: 23936051
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Comparative Coexpression Analysis of Indole Synthase and Tryptophan Synthase A Reveals the Independent Production of Auxin via the Cytosolic Free Indole. DOI: 10.3390/plants12081687 ; PMID: 37111910
- Proteomic study of the Arabidopsis thaliana chloroplastic envelope membrane utilizing alternatives to traditional two-dimensional electrophoresis. DOI: 10.1021/pr034025j ; PMID: 12938931
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
Sequences
cDNA Sequence
- >AT5G17990.1
AGTCATTCAGTAATCAACAAATATATTCATATGAAACCCAAAATAAAATAAAATAAACACTTTTCAAGAAAAAAATAAAATACTGAGTACTAAACTGGAAACCCTTTATAAGCAAAAAGACCAAAAGTTAAAAGTTAATTAAGATTTGGTTTAAGGCGCTTTGCTTTATTAGAGAGGAAGGAACGAACCATCATAGAAATCTCTCCTTCGTTCAAGTTTTTCTCTACTGTGTTGGTTGAGCAATCGAGTGATGGTTATTGCGGTGGCGACGACGAGCTCCATTGTTTCCGGAATCAAGCTTTCAGGGATCTTAACTTCGTTCAACGCCGTAGATGATGCGTCCAGTAGTTGCGGAAGAAGCAACTTGACCGGAGTTAGAATTTTTCCGACATTGAGTCGGCGACGATTCTCATCGATCGGAGCTGTTTCCCCAATTCGTGGGGATGCTCAATCTTCCTTTAGTCGCAGCTCTTTCGCTTGCTCTCAGAATCTCGGTTTGAGCGGTGGATTTAGTGCAGCTGAAGCTCTGCCACCTGCTTGTGCAAATGCTAGCCCTTCTTCCATTAAATCTTTCAACCAGTTGATTGAAACCTTGATTGATCGGGTTGATCTATCTGAAACTGAGGCTGAATCATCTCTTGAGTTTTTGCTGAATGAGGCAAACGAGGCGCTGATCAGTGCCTTTCTAGTTCTTCTGAGAGCTAAAGGAGAGACATACGAAGAGATTGTGGGGTTAGCTAGGGCAATGATGAAGCATGCCAGGAAAGTGGAAGGATTAGTTGATGCTGTGGACATAGTTGGAACAGGTGGTGATGGAGCAAACACAGTCAATATATCAACTGGATCTTCAATACTTGCTGCAGCTTGTGGTGCAAAAGTAGCAAAGCAAGGGAATCGTTCAAGTTCTTCTGCTTGTGGAAGTGCTGATGTACTAGAGGCACTAGGAGTGGTTCTGGACTTGGGACCAGAGGGCATTAAAAGATGTGTTGAAGAAGGGGGGATCGGTTTTATGATGTCACCAATGTATCATCCAGCTATGAAGATCGTTGGTCCTGTTCGGAAAAAGCTTAAAATTAAAACTGTTTTTAACATATTGGGACCTATGCTTAATCCTGCTAGAGTTTCTTATGCTGTCGTTGGTGTATACCACAAAGATCTGGTTGTTAAGATGGCAAAGGCACTGCAACGATTTGGAATGAAAAGAGCACTGGTGGTTCATTCATGTGGTCTAGACGAAATGAGTCCGTTAGGAGGAGGACTAGTTTATGATGTAACTCCGGAAAAGATCGAAGAATTCTCATTCGACCCATTGGACTTTGGTATTCCTCGTTGTACTCTTGAGGATTTGCGAGGTGGAGGTCCAGACTACAATGCGGATGTGCTAAGACGTGTGCTTTCAGGGGAAAGTGGAGCAATTGCGGATTCATTGATCCTAAACGCAGCTGCAGCTCTTCTGGTTAGCAACCGAGTTCAAACGCTAGCTGAAGGAGTAACCGTGGCACGTGAAGTACAATCGTCTGGGAAAGCTATCAAGACGCTTGATTCTTGGATAAACATCTCAAACTTAGCTCAGAAATCTCAGTGACCAGAAGAGGCTTATGATATTGTTGTATTCAACGGATCACCTTTGCAAGCAATTGTAGATGAAGATGGAGGCAATGTGCCAAAGGAAGAAGCTGGAGTTATTTGTAACTTAAGTTTTCTTTGTCAAACAATAAAGAGAAGAGACCGGAGCGAGCTCTATACACATTCATCATGTAAACACTACAACAATAATCTTTAATAAAATGAATAAATCTGTTTTACTCAAACGGAGTTCAGATTCATCATTGGGATACAAATCAAACCTAAGTAGTAAGTAGAAAAACAAAATTATAAAATTAGTCCTAACATTGAATCACAGACCATAATCTTGTTCCGAAGTTCTTCACTAATTCTGCAACTACACCTAAAATATCATCATCGTCATGGTGTCTATTCTTTGGAGACTTTCACACGCATCTCTGTCGGTTTGATGAGCTTGAACGTACAAACATCTCCGACCAGTAAACCTAACTCCTTGGCCAAACGACTCCATCCACCAGAGAATCTTGATTGTACATCAG
CDS Sequence
Protein Sequence